Incidental Mutation 'R2403:F11'
ID248820
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Namecoagulation factor XI
SynonymsFXI, plasma thromboplastin antecedent, Cf11, 1600027G01Rik
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45241174-45262031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45248638 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 353 (S353P)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
Predicted Effect probably damaging
Transcript: ENSMUST00000034064
AA Change: S353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: S353P

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210622
Meta Mutation Damage Score 0.5090 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45250095 missense probably damaging 1.00
IGL02096:F11 APN 8 45246754 missense probably benign 0.05
IGL02363:F11 APN 8 45241531 missense probably damaging 1.00
IGL02694:F11 APN 8 45252159 missense probably damaging 1.00
IGL03374:F11 APN 8 45261074 missense possibly damaging 0.63
R0225:F11 UTSW 8 45249077 missense probably benign 0.00
R0525:F11 UTSW 8 45253049 missense probably benign 0.01
R0842:F11 UTSW 8 45252159 missense probably damaging 1.00
R0961:F11 UTSW 8 45241494 missense probably damaging 1.00
R1605:F11 UTSW 8 45241580 missense probably damaging 1.00
R2044:F11 UTSW 8 45252118 missense probably benign 0.03
R2113:F11 UTSW 8 45246832 missense probably benign 0.00
R2273:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2274:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2275:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2318:F11 UTSW 8 45248638 missense probably damaging 1.00
R2319:F11 UTSW 8 45248638 missense probably damaging 1.00
R2510:F11 UTSW 8 45248638 missense probably damaging 1.00
R2512:F11 UTSW 8 45261061 missense probably benign 0.01
R2893:F11 UTSW 8 45248638 missense probably damaging 1.00
R2894:F11 UTSW 8 45248638 missense probably damaging 1.00
R2910:F11 UTSW 8 45241449 makesense probably null
R3030:F11 UTSW 8 45248638 missense probably damaging 1.00
R3105:F11 UTSW 8 45245717 missense probably damaging 0.97
R3721:F11 UTSW 8 45248638 missense probably damaging 1.00
R3726:F11 UTSW 8 45248638 missense probably damaging 1.00
R3906:F11 UTSW 8 45248638 missense probably damaging 1.00
R3909:F11 UTSW 8 45248638 missense probably damaging 1.00
R4465:F11 UTSW 8 45241474 missense probably damaging 1.00
R4467:F11 UTSW 8 45241474 missense probably damaging 1.00
R4710:F11 UTSW 8 45250146 missense probably damaging 1.00
R4824:F11 UTSW 8 45255342 missense probably damaging 0.99
R4968:F11 UTSW 8 45245733 missense probably benign 0.19
R5225:F11 UTSW 8 45255304 missense probably benign 0.09
R5288:F11 UTSW 8 45246796 missense probably damaging 1.00
R5378:F11 UTSW 8 45252143 missense probably benign 0.19
R6155:F11 UTSW 8 45252082 missense probably damaging 1.00
R6213:F11 UTSW 8 45241500 missense probably damaging 1.00
R6615:F11 UTSW 8 45248774 missense probably benign
R6797:F11 UTSW 8 45253055 missense probably benign 0.02
R7147:F11 UTSW 8 45250146 missense probably damaging 1.00
R7683:F11 UTSW 8 45249508 missense probably damaging 0.97
R7688:F11 UTSW 8 45250090 missense probably damaging 1.00
R7720:F11 UTSW 8 45252090 missense possibly damaging 0.89
U24488:F11 UTSW 8 45242312 missense probably benign 0.04
Z1088:F11 UTSW 8 45245772 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTCTCTATGGTTGTTGTAGACTAGC -3'
(R):5'- AAGAGCTGGACATCGTCGATG -3'

Sequencing Primer
(F):5'- ACTAGCCTCGTGTAGTAGACTAGC -3'
(R):5'- CATCGTCGATGTGAAAGGCC -3'
Posted On2014-11-11