Incidental Mutation 'R0317:Tmco1'
ID25427
Institutional Source Beutler Lab
Gene Symbol Tmco1
Ensembl Gene ENSMUSG00000052428
Gene Nametransmembrane and coiled-coil domains 1
SynonymsESTM39, 4930403O06Rik, 1190006A08Rik
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0317 (G1)
Quality Score176
Status Not validated
Chromosome1
Chromosomal Location167308378-167333978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167325893 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000142042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097473] [ENSMUST00000195015]
Predicted Effect probably damaging
Transcript: ENSMUST00000097473
AA Change: V114A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095081
Gene: ENSMUSG00000052428
AA Change: V114A

DomainStartEndE-ValueType
Pfam:DUF106 3 166 6.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193101
Predicted Effect possibly damaging
Transcript: ENSMUST00000193446
AA Change: V125A

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000195015
AA Change: V114A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142042
Gene: ENSMUSG00000052428
AA Change: V114A

DomainStartEndE-ValueType
Pfam:DUF106 3 166 2.7e-51 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a transmembrane protein. Mutations at this locus have been associated with craniofacial dysmorphism, skeletal anomalies, and mental retardation. Mutations at this locus have also been associated with open angle glaucoma blindness. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, postnatal growth retardation, delayed osteogenesis, craniofacial anomalies, enlarged brain ventricles, impaired coordination and spatial recognition memory, abnormal calcium ion homeostasis, and decreased survivor rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Tmco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Tmco1 APN 1 167316268 missense probably damaging 1.00
IGL02619:Tmco1 APN 1 167326028 splice site probably benign
IGL03093:Tmco1 APN 1 167316279 missense probably damaging 1.00
R1704:Tmco1 UTSW 1 167325937 missense possibly damaging 0.64
R7144:Tmco1 UTSW 1 167308453 start gained probably benign
R7540:Tmco1 UTSW 1 167326003 missense
Predicted Primers PCR Primer
(F):5'- TTCCTACCAGAAGCATGGAGAGGC -3'
(R):5'- GCAGAGCTAGTGTGATCTAGCAGTG -3'

Sequencing Primer
(F):5'- CATGGAGAGGCACTTGTTTCAG -3'
(R):5'- TGTGATCTAGCAGTGGCAGAAAG -3'
Posted On2013-04-16