Incidental Mutation 'R2969:Pfpl'
ID256072
Institutional Source Beutler Lab
Gene Symbol Pfpl
Ensembl Gene ENSMUSG00000040065
Gene Namepore forming protein-like
SynonymsEpcs5, Epcs50
Accession Numbers

Genbank: NM_019540; MGI: 1860266

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2969 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12427905-12432110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12429543 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 386 (R386L)
Ref Sequence ENSEMBL: ENSMUSP00000126346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168148]
Predicted Effect probably benign
Transcript: ENSMUST00000168148
AA Change: R386L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: R386L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MACPF 144 343 6.26e-33 SMART
transmembrane domain 643 665 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A G 10: 69,994,395 T137A probably damaging Het
Antxr2 A T 5: 98,030,416 L45* probably null Het
Armc1 T C 3: 19,134,860 S214G probably benign Het
Arsj T C 3: 126,439,372 I589T probably benign Het
C8a A G 4: 104,853,777 S230P probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Gm21976 A G 13: 98,287,282 Y33C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gtf2i A G 5: 134,251,892 V556A probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Ing4 A G 6: 125,047,325 K131E probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nap1l2 A T X: 103,185,648 D221E probably benign Het
Nepn A T 10: 52,400,887 R179* probably null Het
Nrxn3 G A 12: 89,354,471 C383Y probably damaging Het
Rere A G 4: 150,570,216 K402E unknown Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc43a1 C T 2: 84,857,335 T395I probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r128 T A 7: 21,350,121 V250D probably damaging Het
Other mutations in Pfpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pfpl APN 19 12429645 missense probably benign 0.00
IGL01298:Pfpl APN 19 12428673 missense possibly damaging 0.68
IGL01310:Pfpl APN 19 12428610 missense probably damaging 1.00
IGL02273:Pfpl APN 19 12429963 missense possibly damaging 0.96
IGL02532:Pfpl APN 19 12428845 missense probably damaging 1.00
IGL02611:Pfpl APN 19 12430283 missense probably benign
IGL02642:Pfpl APN 19 12429743 missense probably damaging 1.00
IGL02715:Pfpl APN 19 12429781 nonsense probably null
IGL03087:Pfpl APN 19 12428877 missense probably benign 0.06
IGL03223:Pfpl APN 19 12430074 missense probably damaging 1.00
IGL03253:Pfpl APN 19 12430029 missense probably damaging 0.99
D3080:Pfpl UTSW 19 12428832 missense probably damaging 0.98
R0276:Pfpl UTSW 19 12429237 missense probably damaging 1.00
R0433:Pfpl UTSW 19 12429475 missense probably damaging 1.00
R1004:Pfpl UTSW 19 12430425 missense probably benign 0.00
R1510:Pfpl UTSW 19 12429696 missense probably benign 0.31
R1759:Pfpl UTSW 19 12429860 missense probably damaging 1.00
R2009:Pfpl UTSW 19 12429955 missense possibly damaging 0.95
R2063:Pfpl UTSW 19 12429873 missense probably damaging 1.00
R2201:Pfpl UTSW 19 12430479 missense probably benign 0.01
R2656:Pfpl UTSW 19 12430236 missense probably benign
R3003:Pfpl UTSW 19 12430326 missense possibly damaging 0.90
R3428:Pfpl UTSW 19 12430313 missense probably benign 0.37
R3904:Pfpl UTSW 19 12430437 missense probably benign 0.00
R4049:Pfpl UTSW 19 12429689 missense probably damaging 1.00
R4717:Pfpl UTSW 19 12429254 missense probably benign 0.07
R5343:Pfpl UTSW 19 12428688 missense probably damaging 0.99
R5804:Pfpl UTSW 19 12429663 missense probably benign 0.00
R6032:Pfpl UTSW 19 12429383 missense probably damaging 0.99
R6032:Pfpl UTSW 19 12429383 missense probably damaging 0.99
R6047:Pfpl UTSW 19 12429233 missense probably damaging 1.00
R6106:Pfpl UTSW 19 12429461 missense probably damaging 0.99
R6657:Pfpl UTSW 19 12429926 missense probably benign 0.36
R7467:Pfpl UTSW 19 12428514 missense probably damaging 1.00
R7720:Pfpl UTSW 19 12429174 missense probably benign 0.02
R8024:Pfpl UTSW 19 12430206 missense possibly damaging 0.94
R8370:Pfpl UTSW 19 12429911 missense probably damaging 0.99
Z1176:Pfpl UTSW 19 12429941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAACCTGAAAAGCTTCCTGC -3'
(R):5'- TTGGCCACTCTGAACTCATC -3'

Sequencing Primer
(F):5'- ACTTGGTGGAGCAACTGGC -3'
(R):5'- CTCATCTTTACACGATGTACGACAG -3'
Posted On2014-12-29