Incidental Mutation 'R6657:Pfpl'
ID 526691
Institutional Source Beutler Lab
Gene Symbol Pfpl
Ensembl Gene ENSMUSG00000040065
Gene Name pore forming protein-like
Synonyms Epcs5, Epcs50
MMRRC Submission
Accession Numbers

Genbank: NM_019540; MGI: 1860266

Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 12427905-12432110 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12429926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 514 (V514I)
Ref Sequence ENSEMBL: ENSMUSP00000126346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168148]
AlphaFold Q5RKV8
Predicted Effect probably benign
Transcript: ENSMUST00000168148
AA Change: V514I

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: V514I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MACPF 144 343 6.26e-33 SMART
transmembrane domain 643 665 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Pfpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pfpl APN 19 12429645 missense probably benign 0.00
IGL01298:Pfpl APN 19 12428673 missense possibly damaging 0.68
IGL01310:Pfpl APN 19 12428610 missense probably damaging 1.00
IGL02273:Pfpl APN 19 12429963 missense possibly damaging 0.96
IGL02532:Pfpl APN 19 12428845 missense probably damaging 1.00
IGL02611:Pfpl APN 19 12430283 missense probably benign
IGL02642:Pfpl APN 19 12429743 missense probably damaging 1.00
IGL02715:Pfpl APN 19 12429781 nonsense probably null
IGL03087:Pfpl APN 19 12428877 missense probably benign 0.06
IGL03223:Pfpl APN 19 12430074 missense probably damaging 1.00
IGL03253:Pfpl APN 19 12430029 missense probably damaging 0.99
D3080:Pfpl UTSW 19 12428832 missense probably damaging 0.98
R0276:Pfpl UTSW 19 12429237 missense probably damaging 1.00
R0433:Pfpl UTSW 19 12429475 missense probably damaging 1.00
R1004:Pfpl UTSW 19 12430425 missense probably benign 0.00
R1510:Pfpl UTSW 19 12429696 missense probably benign 0.31
R1759:Pfpl UTSW 19 12429860 missense probably damaging 1.00
R2009:Pfpl UTSW 19 12429955 missense possibly damaging 0.95
R2063:Pfpl UTSW 19 12429873 missense probably damaging 1.00
R2201:Pfpl UTSW 19 12430479 missense probably benign 0.01
R2656:Pfpl UTSW 19 12430236 missense probably benign
R2969:Pfpl UTSW 19 12429543 missense probably benign 0.00
R3003:Pfpl UTSW 19 12430326 missense possibly damaging 0.90
R3428:Pfpl UTSW 19 12430313 missense probably benign 0.37
R3904:Pfpl UTSW 19 12430437 missense probably benign 0.00
R4049:Pfpl UTSW 19 12429689 missense probably damaging 1.00
R4717:Pfpl UTSW 19 12429254 missense probably benign 0.07
R5343:Pfpl UTSW 19 12428688 missense probably damaging 0.99
R5804:Pfpl UTSW 19 12429663 missense probably benign 0.00
R6032:Pfpl UTSW 19 12429383 missense probably damaging 0.99
R6032:Pfpl UTSW 19 12429383 missense probably damaging 0.99
R6047:Pfpl UTSW 19 12429233 missense probably damaging 1.00
R6106:Pfpl UTSW 19 12429461 missense probably damaging 0.99
R7467:Pfpl UTSW 19 12428514 missense probably damaging 1.00
R7720:Pfpl UTSW 19 12429174 missense probably benign 0.02
R8024:Pfpl UTSW 19 12430206 missense possibly damaging 0.94
R8370:Pfpl UTSW 19 12429911 missense probably damaging 0.99
R8730:Pfpl UTSW 19 12428580 missense probably damaging 1.00
R8974:Pfpl UTSW 19 12428475 missense probably damaging 1.00
R9147:Pfpl UTSW 19 12428440 missense possibly damaging 0.64
R9148:Pfpl UTSW 19 12428440 missense possibly damaging 0.64
R9248:Pfpl UTSW 19 12429010 missense probably damaging 1.00
R9283:Pfpl UTSW 19 12428856 missense probably damaging 1.00
Z1176:Pfpl UTSW 19 12429941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTTCAGAGTGGCCAAGG -3'
(R):5'- TGTAAAGACTCCAGCCTTGAC -3'

Sequencing Primer
(F):5'- TGGCCAAGGCTGAAGTTAGCTC -3'
(R):5'- GTAGGACACTTGGCATCCATCAATG -3'
Posted On 2018-07-23