Mutagenetix > Incidental Mutation

Incidental Mutation 'R6657:Pfpl'

526691

Institutional Source

Beutler Lab

Gene Symbol

Pfpl

Ensembl Gene

ENSMUSG00000040065

Gene Name

pore forming protein-like

Synonyms

Epcs5, Epcs50

MMRRC Submission

Accession Numbers

Genbank: NM_019540; MGI: 1860266

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12427905-12432110 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12429926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 514 (V514I)

Ref Sequence

ENSEMBL: ENSMUSP00000126346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168148]

AlphaFold

Q5RKV8

Predicted Effect

probably benign
Transcript: ENSMUST00000168148
AA Change: V514I

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: V514I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
MACPF	144	343	6.26e-33	SMART
transmembrane domain	643	665	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Pfpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pfpl	APN	19	12429645	missense	probably benign	0.00
IGL01298:Pfpl	APN	19	12428673	missense	possibly damaging	0.68
IGL01310:Pfpl	APN	19	12428610	missense	probably damaging	1.00
IGL02273:Pfpl	APN	19	12429963	missense	possibly damaging	0.96
IGL02532:Pfpl	APN	19	12428845	missense	probably damaging	1.00
IGL02611:Pfpl	APN	19	12430283	missense	probably benign
IGL02642:Pfpl	APN	19	12429743	missense	probably damaging	1.00
IGL02715:Pfpl	APN	19	12429781	nonsense	probably null
IGL03087:Pfpl	APN	19	12428877	missense	probably benign	0.06
IGL03223:Pfpl	APN	19	12430074	missense	probably damaging	1.00
IGL03253:Pfpl	APN	19	12430029	missense	probably damaging	0.99
pegged	UTSW	19	12429010	missense	probably damaging	1.00
D3080:Pfpl	UTSW	19	12428832	missense	probably damaging	0.98
R0276:Pfpl	UTSW	19	12429237	missense	probably damaging	1.00
R0433:Pfpl	UTSW	19	12429475	missense	probably damaging	1.00
R1004:Pfpl	UTSW	19	12430425	missense	probably benign	0.00
R1510:Pfpl	UTSW	19	12429696	missense	probably benign	0.31
R1759:Pfpl	UTSW	19	12429860	missense	probably damaging	1.00
R2009:Pfpl	UTSW	19	12429955	missense	possibly damaging	0.95
R2063:Pfpl	UTSW	19	12429873	missense	probably damaging	1.00
R2201:Pfpl	UTSW	19	12430479	missense	probably benign	0.01
R2656:Pfpl	UTSW	19	12430236	missense	probably benign
R2969:Pfpl	UTSW	19	12429543	missense	probably benign	0.00
R3003:Pfpl	UTSW	19	12430326	missense	possibly damaging	0.90
R3428:Pfpl	UTSW	19	12430313	missense	probably benign	0.37
R3904:Pfpl	UTSW	19	12430437	missense	probably benign	0.00
R4049:Pfpl	UTSW	19	12429689	missense	probably damaging	1.00
R4717:Pfpl	UTSW	19	12429254	missense	probably benign	0.07
R5343:Pfpl	UTSW	19	12428688	missense	probably damaging	0.99
R5804:Pfpl	UTSW	19	12429663	missense	probably benign	0.00
R6032:Pfpl	UTSW	19	12429383	missense	probably damaging	0.99
R6032:Pfpl	UTSW	19	12429383	missense	probably damaging	0.99
R6047:Pfpl	UTSW	19	12429233	missense	probably damaging	1.00
R6106:Pfpl	UTSW	19	12429461	missense	probably damaging	0.99
R7467:Pfpl	UTSW	19	12428514	missense	probably damaging	1.00
R7720:Pfpl	UTSW	19	12429174	missense	probably benign	0.02
R8024:Pfpl	UTSW	19	12430206	missense	possibly damaging	0.94
R8370:Pfpl	UTSW	19	12429911	missense	probably damaging	0.99
R8730:Pfpl	UTSW	19	12428580	missense	probably damaging	1.00
R8974:Pfpl	UTSW	19	12428475	missense	probably damaging	1.00
R9147:Pfpl	UTSW	19	12428440	missense	possibly damaging	0.64
R9148:Pfpl	UTSW	19	12428440	missense	possibly damaging	0.64
R9248:Pfpl	UTSW	19	12429010	missense	probably damaging	1.00
R9283:Pfpl	UTSW	19	12428856	missense	probably damaging	1.00
R9542:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9560:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9561:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9663:Pfpl	UTSW	19	12430095	missense	probably damaging	1.00
R9670:Pfpl	UTSW	19	12429743	missense	probably damaging	1.00
R9721:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9722:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9723:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9759:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9761:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9762:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
Z1176:Pfpl	UTSW	19	12429941	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGTTCAGAGTGGCCAAGG -3'
(R):5'- TGTAAAGACTCCAGCCTTGAC -3'

Sequencing Primer
(F):5'- TGGCCAAGGCTGAAGTTAGCTC -3'
(R):5'- GTAGGACACTTGGCATCCATCAATG -3'

Posted On

2018-07-23