Incidental Mutation 'R3012:Tubb3'
ID 257538
Institutional Source Beutler Lab
Gene Symbol Tubb3
Ensembl Gene ENSMUSG00000062380
Gene Name tubulin, beta 3 class III
Synonyms betaIII-tubulin, 3200002H15Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3012 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 123411424-123422015 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 123421236 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 303 (C303G)
Ref Sequence ENSEMBL: ENSMUSP00000071134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071134] [ENSMUST00000127664] [ENSMUST00000212743] [ENSMUST00000212883]
AlphaFold Q9ERD7
Predicted Effect probably damaging
Transcript: ENSMUST00000071134
AA Change: C303G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071134
Gene: ENSMUSG00000062380
AA Change: C303G

DomainStartEndE-ValueType
Tubulin 47 244 8.63e-65 SMART
Tubulin_C 246 383 1.35e-48 SMART
low complexity region 427 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212743
Predicted Effect probably benign
Transcript: ENSMUST00000212883
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit neonatal lethality associated with respiratory distress, abnormal corpus callosum morphology, abnormal cranial nerves, and defective axon guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,557,691 Y585* probably null Het
Ankrd17 G A 5: 90,230,868 P2563S probably damaging Het
Atg10 A T 13: 91,154,278 F47Y probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cfi A G 3: 129,874,930 D535G probably damaging Het
Dgat1 T A 15: 76,503,393 Q308H possibly damaging Het
Dsp T C 13: 38,193,342 I1701T possibly damaging Het
E330009J07Rik T C 6: 40,435,992 E45G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fes G C 7: 80,387,167 S56R possibly damaging Het
Gria1 G A 11: 57,289,434 V737M probably damaging Het
Gtf2h1 A G 7: 46,803,895 H84R probably damaging Het
Ifi208 A G 1: 173,695,570 probably null Het
Il15 T A 8: 82,344,420 N22I probably damaging Het
Me1 A G 9: 86,611,912 S323P probably benign Het
Olfr713 T C 7: 107,036,362 F69S possibly damaging Het
Parp4 T C 14: 56,595,416 probably null Het
Pcdhga7 A G 18: 37,715,638 T233A probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rpe65 G T 3: 159,604,563 V128F possibly damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tbc1d32 A G 10: 56,173,915 V509A probably benign Het
Tln1 T A 4: 43,542,525 T1428S probably benign Het
Ttc27 A T 17: 74,840,459 I669F probably benign Het
Tulp2 G T 7: 45,518,763 V188L probably damaging Het
Zfr T C 15: 12,166,163 Y840H probably damaging Het
Other mutations in Tubb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Tubb3 APN 8 123420966 missense probably benign 0.20
IGL02208:Tubb3 APN 8 123420864 missense probably damaging 1.00
IGL02253:Tubb3 APN 8 123420820 missense probably benign 0.17
IGL02669:Tubb3 APN 8 123421117 missense probably damaging 0.98
F5770:Tubb3 UTSW 8 123411675 splice site probably benign
PIT4810001:Tubb3 UTSW 8 123421657 missense possibly damaging 0.72
R1164:Tubb3 UTSW 8 123421447 missense probably damaging 1.00
R2074:Tubb3 UTSW 8 123421270 missense probably damaging 1.00
R2075:Tubb3 UTSW 8 123421270 missense probably damaging 1.00
R2091:Tubb3 UTSW 8 123421678 splice site probably null
R3913:Tubb3 UTSW 8 123421009 missense possibly damaging 0.94
R3951:Tubb3 UTSW 8 123421264 missense probably damaging 0.99
R4609:Tubb3 UTSW 8 123420919 missense probably damaging 1.00
R5054:Tubb3 UTSW 8 123420868 missense probably damaging 0.99
R5256:Tubb3 UTSW 8 123421652 missense probably benign
R5690:Tubb3 UTSW 8 123421306 missense probably benign 0.14
R7638:Tubb3 UTSW 8 123421161 missense probably benign 0.04
R8263:Tubb3 UTSW 8 123421129 missense possibly damaging 0.90
R8320:Tubb3 UTSW 8 123420855 missense possibly damaging 0.80
R8503:Tubb3 UTSW 8 123421029 missense probably damaging 0.99
R9030:Tubb3 UTSW 8 123418957 missense probably damaging 1.00
Z1088:Tubb3 UTSW 8 123421534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGTCTGCCACCATGAGTG -3'
(R):5'- ATGACATTTTGAGCCCACGG -3'

Sequencing Primer
(F):5'- GATTCCCTGGTCAGCTCAATG -3'
(R):5'- ACGGGGTGGGATGTCAC -3'
Posted On 2015-01-11