Mutagenetix > Incidental Mutation

Incidental Mutation 'R3012:Ccdc39'

257526

Institutional Source

Beutler Lab

Gene Symbol

Ccdc39

Ensembl Gene

ENSMUSG00000027676

Gene Name

coiled-coil domain containing 39

Synonyms

b2b2025.1Clo, b2b1735Clo, 4921507O14Rik, D3Ertd789e, b2b1304Clo

Accession Numbers

Essential gene?

Probably essential (E-score: 0.851) question?

Stock #

R3012 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33812362-33844310 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33814668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 798 (R798Q)

Ref Sequence

ENSEMBL: ENSMUSP00000029222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000199222]

AlphaFold

Q9D5Y1

Predicted Effect

probably damaging
Transcript: ENSMUST00000029222
AA Change: R798Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: R798Q

Domain	Start	End	E-Value	Type
coiled coil region	16	67	N/A	INTRINSIC
coiled coil region	164	198	N/A	INTRINSIC
coiled coil region	232	339	N/A	INTRINSIC
low complexity region	381	393	N/A	INTRINSIC
internal_repeat_1	569	603	1.19e-5	PROSPERO
internal_repeat_1	598	635	1.19e-5	PROSPERO
coiled coil region	664	704	N/A	INTRINSIC
coiled coil region	726	766	N/A	INTRINSIC
low complexity region	873	889	N/A	INTRINSIC
low complexity region	915	928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099153

SMART Domains

Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677

Domain	Start	End	E-Value	Type
low complexity region	38	56	N/A	INTRINSIC
S1	123	207	7.28e-2	SMART
TPR	306	339	6.19e-1	SMART
TPR	340	373	2.11e-3	SMART
TPR	381	414	1.88e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108210

SMART Domains

Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677

Domain	Start	End	E-Value	Type
low complexity region	38	56	N/A	INTRINSIC
S1	123	207	7.28e-2	SMART
TPR	306	339	6.19e-1	SMART
TPR	340	373	2.11e-3	SMART
TPR	381	414	1.88e0	SMART
coiled coil region	415	476	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117915

SMART Domains

Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677

Domain	Start	End	E-Value	Type
low complexity region	38	56	N/A	INTRINSIC
S1	123	207	7.28e-2	SMART
TPR	254	287	6.19e-1	SMART
TPR	288	321	2.11e-3	SMART
TPR	329	362	1.88e0	SMART
coiled coil region	363	424	N/A	INTRINSIC
low complexity region	565	578	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197317

Predicted Effect

probably benign
Transcript: ENSMUST00000199222

SMART Domains

Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677

Domain	Start	End	E-Value	Type
low complexity region	38	56	N/A	INTRINSIC
S1	123	207	7.28e-2	SMART
TPR	306	339	6.19e-1	SMART
TPR	340	373	2.11e-3	SMART
TPR	381	414	1.88e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200300

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200536

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh18a1	G	T	19: 40,557,691	Y585*	probably null	Het
Ankrd17	G	A	5: 90,230,868	P2563S	probably damaging	Het
Atg10	A	T	13: 91,154,278	F47Y	probably damaging	Het
Cfi	A	G	3: 129,874,930	D535G	probably damaging	Het
Dgat1	T	A	15: 76,503,393	Q308H	possibly damaging	Het
Dsp	T	C	13: 38,193,342	I1701T	possibly damaging	Het
E330009J07Rik	T	C	6: 40,435,992	E45G	probably benign	Het
Egr2	GAA	GA	10: 67,539,903		probably null	Het
Fes	G	C	7: 80,387,167	S56R	possibly damaging	Het
Gria1	G	A	11: 57,289,434	V737M	probably damaging	Het
Gtf2h1	A	G	7: 46,803,895	H84R	probably damaging	Het
Ifi208	A	G	1: 173,695,570		probably null	Het
Il15	T	A	8: 82,344,420	N22I	probably damaging	Het
Me1	A	G	9: 86,611,912	S323P	probably benign	Het
Olfr713	T	C	7: 107,036,362	F69S	possibly damaging	Het
Parp4	T	C	14: 56,595,416		probably null	Het
Pcdhga7	A	G	18: 37,715,638	T233A	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rpe65	G	T	3: 159,604,563	V128F	possibly damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Tbc1d32	A	G	10: 56,173,915	V509A	probably benign	Het
Tln1	T	A	4: 43,542,525	T1428S	probably benign	Het
Ttc27	A	T	17: 74,840,459	I669F	probably benign	Het
Tubb3	T	G	8: 123,421,236	C303G	probably damaging	Het
Tulp2	G	T	7: 45,518,763	V188L	probably damaging	Het
Zfr	T	C	15: 12,166,163	Y840H	probably damaging	Het

Other mutations in Ccdc39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02093:Ccdc39	APN	3	33832568	missense	probably benign	0.16
IGL02321:Ccdc39	APN	3	33816958	unclassified	probably benign
IGL02426:Ccdc39	APN	3	33825398	missense	possibly damaging	0.85
IGL02930:Ccdc39	APN	3	33825494	missense	probably damaging	1.00
IGL03027:Ccdc39	APN	3	33830118	missense	probably benign	0.06
IGL03347:Ccdc39	APN	3	33837843	missense	probably damaging	1.00
R0046:Ccdc39	UTSW	3	33844152	missense	possibly damaging	0.52
R0046:Ccdc39	UTSW	3	33844152	missense	possibly damaging	0.52
R0601:Ccdc39	UTSW	3	33819839	missense	probably damaging	0.99
R0975:Ccdc39	UTSW	3	33844125	missense	probably damaging	1.00
R1075:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1224:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1251:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1252:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1254:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1255:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1331:Ccdc39	UTSW	3	33815485	missense	probably benign	0.34
R1370:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1385:Ccdc39	UTSW	3	33821412	missense	probably damaging	0.99
R1416:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1491:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1513:Ccdc39	UTSW	3	33839145	missense	possibly damaging	0.60
R1769:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1965:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R1966:Ccdc39	UTSW	3	33826480	missense	probably damaging	0.99
R2061:Ccdc39	UTSW	3	33819896	missense	probably damaging	0.97
R2109:Ccdc39	UTSW	3	33815501	missense	probably damaging	0.97
R2183:Ccdc39	UTSW	3	33821432	missense	possibly damaging	0.46
R2207:Ccdc39	UTSW	3	33836733	missense	probably damaging	0.97
R2208:Ccdc39	UTSW	3	33841178	missense	probably damaging	0.99
R2267:Ccdc39	UTSW	3	33815484	missense	probably damaging	0.99
R3013:Ccdc39	UTSW	3	33814668	missense	probably damaging	1.00
R3120:Ccdc39	UTSW	3	33837838	missense	probably damaging	1.00
R3415:Ccdc39	UTSW	3	33814497	missense	probably benign	0.02
R3802:Ccdc39	UTSW	3	33819895	missense	probably damaging	1.00
R3804:Ccdc39	UTSW	3	33819895	missense	probably damaging	1.00
R4107:Ccdc39	UTSW	3	33825479	missense	probably damaging	1.00
R4334:Ccdc39	UTSW	3	33837882	missense	probably damaging	1.00
R4367:Ccdc39	UTSW	3	33826522	missense	probably benign	0.01
R4462:Ccdc39	UTSW	3	33814668	missense	probably damaging	1.00
R4653:Ccdc39	UTSW	3	33819806	critical splice donor site	probably null
R4723:Ccdc39	UTSW	3	33813078	missense	possibly damaging	0.66
R4908:Ccdc39	UTSW	3	33839093	splice site	probably null
R5236:Ccdc39	UTSW	3	33830102	missense	probably damaging	1.00
R5646:Ccdc39	UTSW	3	33825550	missense	probably damaging	1.00
R5705:Ccdc39	UTSW	3	33816937	missense	probably damaging	1.00
R5739:Ccdc39	UTSW	3	33826561	missense	possibly damaging	0.95
R6130:Ccdc39	UTSW	3	33841192	splice site	probably null
R6375:Ccdc39	UTSW	3	33814367	missense	probably benign	0.38
R6548:Ccdc39	UTSW	3	33837959	missense	probably benign	0.03
R6709:Ccdc39	UTSW	3	33830093	missense	possibly damaging	0.52
R6858:Ccdc39	UTSW	3	33819868	missense	probably damaging	1.00
R7183:Ccdc39	UTSW	3	33814471	missense	probably damaging	1.00
R7269:Ccdc39	UTSW	3	33830105	missense	probably benign	0.00
R7348:Ccdc39	UTSW	3	33832676	missense	possibly damaging	0.55
R7645:Ccdc39	UTSW	3	33825169	splice site	probably null
R7695:Ccdc39	UTSW	3	33814519	missense	probably damaging	1.00
R7752:Ccdc39	UTSW	3	33832617	missense	possibly damaging	0.55
R8487:Ccdc39	UTSW	3	33832659	nonsense	probably null
R8523:Ccdc39	UTSW	3	33815411	critical splice donor site	probably null
R8525:Ccdc39	UTSW	3	33814704	missense	probably benign	0.00
R8777:Ccdc39	UTSW	3	33839133	missense	probably benign
R8777-TAIL:Ccdc39	UTSW	3	33839133	missense	probably benign
R8842:Ccdc39	UTSW	3	33826463	missense	probably damaging	1.00
R8932:Ccdc39	UTSW	3	33830125	missense	probably benign	0.00
R8947:Ccdc39	UTSW	3	33815460	unclassified	probably benign
R9207:Ccdc39	UTSW	3	33832557	nonsense	probably null
R9280:Ccdc39	UTSW	3	33816004	missense	probably damaging	0.98
R9462:Ccdc39	UTSW	3	33814370	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCTCACGGAGCTGAATGTC -3'
(R):5'- GCAAATGGCAAGCAATAAGTCTTC -3'

Sequencing Primer
(F):5'- CACGGAGCTGAATGTCCTGTTC -3'
(R):5'- GGACACTTAGCAAATAATGCC -3'

Posted On

2015-01-11