Incidental Mutation 'R7479:Ano9'
ID579676
Institutional Source Beutler Lab
Gene Symbol Ano9
Ensembl Gene ENSMUSG00000054662
Gene Nameanoctamin 9
Synonyms5430425C04Rik, Tmem16j, Trp53i5, Tp53i5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7479 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141101212-141117806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141102435 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 667 (T667A)
Ref Sequence ENSEMBL: ENSMUSP00000067689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067836] [ENSMUST00000097958] [ENSMUST00000209294] [ENSMUST00000210167]
Predicted Effect probably damaging
Transcript: ENSMUST00000067836
AA Change: T667A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: T667A

DomainStartEndE-ValueType
Pfam:Anoctamin 174 730 3.3e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097958
SMART Domains Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

DomainStartEndE-ValueType
IG 17 112 5.21e-2 SMART
transmembrane domain 117 139 N/A INTRINSIC
Pfam:TIR 163 327 2.2e-19 PFAM
Pfam:TIR_2 166 308 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209294
Predicted Effect probably benign
Transcript: ENSMUST00000210167
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,493 M81L probably benign Het
Anpep T A 7: 79,835,370 I623F probably benign Het
Apba2 T C 7: 64,739,859 I501T possibly damaging Het
Ascc3 T A 10: 50,649,799 Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 Y168C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2 A G 17: 34,863,465 C647R probably damaging Het
Cnot4 G A 6: 35,024,148 T604I probably benign Het
Col11a1 C T 3: 114,102,569 T506I unknown Het
Cr2 A C 1: 195,158,410 probably null Het
Ctsm A T 13: 61,537,755 V281D probably damaging Het
Cyp2c69 T C 19: 39,881,557 I74V probably benign Het
Dennd4c T A 4: 86,799,353 V529D probably damaging Het
Dlgap3 C A 4: 127,194,625 H5N possibly damaging Het
Dusp10 C A 1: 184,037,420 H194Q probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln C G 5: 134,707,575 G753A unknown Het
Emb T A 13: 117,249,426 N118K possibly damaging Het
Fam184a C T 10: 53,655,014 V755I probably benign Het
Fryl A G 5: 73,097,561 I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 I722F probably damaging Het
Gabrb3 T A 7: 57,824,423 D362E possibly damaging Het
Galnt2 G A 8: 124,334,338 G357D probably damaging Het
Gbx2 A T 1: 89,930,651 S35R probably benign Het
Glg1 A G 8: 111,197,735 I207T possibly damaging Het
Gm10192 A T 4: 97,183,035 N44K unknown Het
Gpd1 A G 15: 99,720,103 D123G probably benign Het
Grm2 A T 9: 106,653,851 D146E possibly damaging Het
Gsg1l2 A G 11: 67,785,206 D132G probably benign Het
Hecw1 C T 13: 14,340,840 G236R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hspg2 C T 4: 137,539,403 A1934V probably benign Het
Il7r C T 15: 9,513,031 A131T probably damaging Het
Itga6 C T 2: 71,838,336 R540* probably null Het
Kcnh2 A G 5: 24,325,492 probably null Het
Kcnq4 C T 4: 120,715,825 A260T probably damaging Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrrc41 C T 4: 116,089,041 P318S probably damaging Het
Map4 G A 9: 110,068,824 G873R possibly damaging Het
Med24 A G 11: 98,704,961 I968T possibly damaging Het
Mfap5 T C 6: 122,526,862 probably null Het
Mtcl1 A G 17: 66,379,490 V807A probably benign Het
Mug1 T A 6: 121,878,508 S934T possibly damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nkx2-4 T C 2: 147,084,168 E258G probably benign Het
Polr1a T A 6: 71,936,297 V545E probably damaging Het
Ppp1r9b A G 11: 94,992,032 D162G possibly damaging Het
Rhot2 A G 17: 25,840,749 L367P probably damaging Het
Ripk2 A G 4: 16,155,154 F122L probably benign Het
Scn11a T C 9: 119,759,875 T1322A probably benign Het
Scn8a T A 15: 100,955,477 L115Q probably damaging Het
Sel1l3 G T 5: 53,117,120 P1006Q probably damaging Het
Sept11 A T 5: 93,156,945 N207I probably damaging Het
Sez6l2 C T 7: 126,963,659 T669I probably damaging Het
Sfxn4 T A 19: 60,858,674 D57V possibly damaging Het
Smarca2 T A 19: 26,640,487 V306D probably benign Het
Srgap3 C T 6: 112,735,833 probably null Het
Tas2r134 T C 2: 51,627,529 F7L not run Het
Tbcd T C 11: 121,492,605 probably null Het
Tcn2 G A 11: 3,917,703 A413V probably damaging Het
Tdp1 T C 12: 99,891,395 V71A probably benign Het
Tjp1 T C 7: 65,301,180 T1649A probably damaging Het
Tnc T C 4: 64,017,628 E357G possibly damaging Het
Tnrc6b A G 15: 80,889,126 T1158A probably benign Het
Ttn C A 2: 76,738,608 E27314* probably null Het
Vps35 G T 8: 85,270,805 T512K probably benign Het
Zfp40 A T 17: 23,177,318 S98R probably benign Het
Zfp945 A T 17: 22,851,366 C541S possibly damaging Het
Zfp976 T A 7: 42,613,179 E412D probably benign Het
Other mutations in Ano9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ano9 APN 7 141102042 nonsense probably null
IGL01620:Ano9 APN 7 141110439 missense probably damaging 1.00
IGL02045:Ano9 APN 7 141102469 missense probably benign 0.00
IGL02506:Ano9 APN 7 141102254 unclassified probably benign
IGL02657:Ano9 APN 7 141107440 missense probably damaging 1.00
IGL02731:Ano9 APN 7 141107204 missense probably damaging 1.00
IGL02863:Ano9 APN 7 141108651 missense probably benign 0.00
R0114:Ano9 UTSW 7 141103239 unclassified probably benign
R0374:Ano9 UTSW 7 141107814 missense probably damaging 0.98
R0487:Ano9 UTSW 7 141107849 missense possibly damaging 0.85
R0600:Ano9 UTSW 7 141104710 missense probably damaging 1.00
R0702:Ano9 UTSW 7 141107282 missense probably damaging 1.00
R0765:Ano9 UTSW 7 141107184 missense probably damaging 1.00
R1679:Ano9 UTSW 7 141108297 missense probably benign 0.03
R1773:Ano9 UTSW 7 141108378 missense possibly damaging 0.95
R1809:Ano9 UTSW 7 141108804 missense possibly damaging 0.93
R1883:Ano9 UTSW 7 141102331 missense probably benign
R2034:Ano9 UTSW 7 141108135 missense probably damaging 0.99
R2159:Ano9 UTSW 7 141108117 missense probably benign 0.01
R2254:Ano9 UTSW 7 141103090 missense probably benign
R2293:Ano9 UTSW 7 141102515 missense probably benign
R3177:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R3277:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R4274:Ano9 UTSW 7 141110695 missense probably benign
R4576:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4577:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4872:Ano9 UTSW 7 141107204 missense probably damaging 1.00
R4879:Ano9 UTSW 7 141110502 missense probably benign 0.23
R5160:Ano9 UTSW 7 141104365 missense probably damaging 1.00
R5560:Ano9 UTSW 7 141110482 missense probably damaging 1.00
R6148:Ano9 UTSW 7 141106785 missense probably damaging 1.00
R6302:Ano9 UTSW 7 141104308 missense probably damaging 1.00
R6821:Ano9 UTSW 7 141107256 missense possibly damaging 0.70
R7253:Ano9 UTSW 7 141107437 missense probably damaging 0.96
R7836:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R7919:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R8051:Ano9 UTSW 7 141104532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAAGCCCTCTCCTCAGGC -3'
(R):5'- GGGACTTTTCTGATGAAGGAGAATG -3'

Sequencing Primer
(F):5'- TCAGGCTCACTCACAATTTACC -3'
(R):5'- GCCTTCCATGGTGGCTTGC -3'
Posted On2019-10-07