Incidental Mutation 'R2159:Ano9'
ID235052
Institutional Source Beutler Lab
Gene Symbol Ano9
Ensembl Gene ENSMUSG00000054662
Gene Nameanoctamin 9
Synonyms5430425C04Rik, Tmem16j, Trp53i5, Tp53i5
MMRRC Submission 040162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141101212-141117806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141108117 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 229 (I229V)
Ref Sequence ENSEMBL: ENSMUSP00000067689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067836]
Predicted Effect probably benign
Transcript: ENSMUST00000067836
AA Change: I229V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: I229V

DomainStartEndE-ValueType
Pfam:Anoctamin 174 730 3.3e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Ano9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ano9 APN 7 141102042 nonsense probably null
IGL01620:Ano9 APN 7 141110439 missense probably damaging 1.00
IGL02045:Ano9 APN 7 141102469 missense probably benign 0.00
IGL02506:Ano9 APN 7 141102254 unclassified probably benign
IGL02657:Ano9 APN 7 141107440 missense probably damaging 1.00
IGL02731:Ano9 APN 7 141107204 missense probably damaging 1.00
IGL02863:Ano9 APN 7 141108651 missense probably benign 0.00
R0114:Ano9 UTSW 7 141103239 unclassified probably benign
R0374:Ano9 UTSW 7 141107814 missense probably damaging 0.98
R0487:Ano9 UTSW 7 141107849 missense possibly damaging 0.85
R0600:Ano9 UTSW 7 141104710 missense probably damaging 1.00
R0702:Ano9 UTSW 7 141107282 missense probably damaging 1.00
R0765:Ano9 UTSW 7 141107184 missense probably damaging 1.00
R1679:Ano9 UTSW 7 141108297 missense probably benign 0.03
R1773:Ano9 UTSW 7 141108378 missense possibly damaging 0.95
R1809:Ano9 UTSW 7 141108804 missense possibly damaging 0.93
R1883:Ano9 UTSW 7 141102331 missense probably benign
R2034:Ano9 UTSW 7 141108135 missense probably damaging 0.99
R2254:Ano9 UTSW 7 141103090 missense probably benign
R2293:Ano9 UTSW 7 141102515 missense probably benign
R3177:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R3277:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R4274:Ano9 UTSW 7 141110695 missense probably benign
R4576:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4577:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4872:Ano9 UTSW 7 141107204 missense probably damaging 1.00
R4879:Ano9 UTSW 7 141110502 missense probably benign 0.23
R5160:Ano9 UTSW 7 141104365 missense probably damaging 1.00
R5560:Ano9 UTSW 7 141110482 missense probably damaging 1.00
R6148:Ano9 UTSW 7 141106785 missense probably damaging 1.00
R6302:Ano9 UTSW 7 141104308 missense probably damaging 1.00
R6821:Ano9 UTSW 7 141107256 missense possibly damaging 0.70
R7253:Ano9 UTSW 7 141107437 missense probably damaging 0.96
R7479:Ano9 UTSW 7 141102435 missense probably damaging 0.99
R7836:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R7919:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R8051:Ano9 UTSW 7 141104532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGGCTTCATGCTAAGTTTCC -3'
(R):5'- GGCCTCATCGTCTTTCTGAG -3'

Sequencing Primer
(F):5'- AGAACCTGGCTCTTGGGG -3'
(R):5'- CATCGTCTTTCTGAGTGGCTTTGC -3'
Posted On2014-10-01