Incidental Mutation 'R3401:Faim2'
ID259205
Institutional Source Beutler Lab
Gene Symbol Faim2
Ensembl Gene ENSMUSG00000023011
Gene NameFas apoptotic inhibitory molecule 2
Synonymslifeguard, NMP25, Tmbim2, Lfg, 2900002L20Rik
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99497012-99528165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99520348 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 119 (V119I)
Ref Sequence ENSEMBL: ENSMUSP00000155195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023750] [ENSMUST00000231171]
Predicted Effect probably damaging
Transcript: ENSMUST00000023750
AA Change: V131I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023750
Gene: ENSMUSG00000023011
AA Change: V131I

DomainStartEndE-ValueType
Pfam:Bax1-I 101 312 1.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230837
Predicted Effect probably damaging
Transcript: ENSMUST00000231171
AA Change: V119I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.2156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: A mutation in this gene results in kidney abnormalities including enlargement and dilation. A reduced seizure threshold in response to pharmacological agents is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Faim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Faim2 APN 15 99514433 missense probably damaging 1.00
IGL02820:Faim2 APN 15 99521257 missense probably benign 0.02
IGL02989:Faim2 APN 15 99520362 splice site probably benign
R0827:Faim2 UTSW 15 99524736 missense probably benign
R1171:Faim2 UTSW 15 99500254 missense probably benign 0.05
R1678:Faim2 UTSW 15 99520336 missense possibly damaging 0.92
R1785:Faim2 UTSW 15 99512542 missense probably damaging 1.00
R2004:Faim2 UTSW 15 99500246 missense possibly damaging 0.87
R2063:Faim2 UTSW 15 99514433 missense probably damaging 1.00
R4242:Faim2 UTSW 15 99500201 missense probably damaging 1.00
R4664:Faim2 UTSW 15 99524700 critical splice donor site probably null
R4664:Faim2 UTSW 15 99524701 missense probably benign
R4665:Faim2 UTSW 15 99524700 critical splice donor site probably null
R4665:Faim2 UTSW 15 99524701 missense probably benign
R4719:Faim2 UTSW 15 99527579 critical splice donor site probably null
R4952:Faim2 UTSW 15 99521228 missense possibly damaging 0.51
R5973:Faim2 UTSW 15 99521251 missense probably benign
R7162:Faim2 UTSW 15 99521167 critical splice donor site probably null
R7305:Faim2 UTSW 15 99513933 missense probably damaging 0.99
R7601:Faim2 UTSW 15 99500266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGCAATCCAAAAGTTGC -3'
(R):5'- CTGTAAGAAGTTCCCCAAACGG -3'

Sequencing Primer
(F):5'- GCAATCCAAAAGTTGCTTCTGGC -3'
(R):5'- AAGTTCCCCAAACGGTGTGG -3'
Posted On2015-01-23