Mutagenetix > Incidental Mutation

Incidental Mutation 'R2891:Per2'

260087

Institutional Source

Beutler Lab

Gene Symbol

Per2

Ensembl Gene

ENSMUSG00000055866

Gene Name

period circadian clock 2

Synonyms

mPer2

MMRRC Submission

040479-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R2891 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91343704-91387046 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 91373325 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 154 (Q154H)

Ref Sequence

ENSEMBL: ENSMUSP00000066620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069620]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069620
AA Change: Q154H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: Q154H

Domain	Start	End	E-Value	Type
PAS	179	246	3.23e1	SMART
PAS	319	385	5.75e-2	SMART
PAC	393	436	1.6e0	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	821	834	N/A	INTRINSIC
low complexity region	996	1014	N/A	INTRINSIC
Pfam:Period_C	1040	1234	2.7e-93	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185298

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	T	C	5: 81,841,366 (GRCm39)	Y816H	probably damaging	Het
Clcn6	C	T	4: 148,097,073 (GRCm39)		probably null	Het
Farp1	C	T	14: 121,494,148 (GRCm39)	A543V	probably damaging	Het
Hhat	T	C	1: 192,277,394 (GRCm39)	Y355C	probably damaging	Het
Ireb2	A	T	9: 54,807,274 (GRCm39)	H612L	probably benign	Het
Kcnj3	A	T	2: 55,337,027 (GRCm39)	I298F	probably damaging	Het
Kdr	A	G	5: 76,107,496 (GRCm39)	F1016L	probably damaging	Het
Klf7	T	C	1: 64,081,521 (GRCm39)	Y269C	probably damaging	Het
Klhl9	T	C	4: 88,639,207 (GRCm39)	I345V	probably benign	Het
Miga2	A	T	2: 30,268,306 (GRCm39)		probably null	Het
Nadk	A	G	4: 155,671,817 (GRCm39)	N232S	possibly damaging	Het
Ncoa6	T	A	2: 155,279,881 (GRCm39)	D45V	possibly damaging	Het
Pcnx2	A	G	8: 126,617,797 (GRCm39)	S153P	probably damaging	Het
Pik3ap1	G	A	19: 41,364,500 (GRCm39)	A73V	probably benign	Het
Plod3	G	C	5: 137,017,000 (GRCm39)	A50P	probably benign	Het
Rapsn	A	T	2: 90,867,169 (GRCm39)	D157V	probably damaging	Het
Shprh	T	G	10: 11,040,100 (GRCm39)	S4R	probably damaging	Het
Taar8a	G	A	10: 23,953,028 (GRCm39)	V211I	probably benign	Het
Vpreb3	C	T	10: 75,779,056 (GRCm39)		probably benign	Het

Other mutations in Per2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Per2	APN	1	91,376,555 (GRCm39)	missense	probably damaging	0.98
IGL01350:Per2	APN	1	91,358,583 (GRCm39)	missense	probably damaging	1.00
IGL01865:Per2	APN	1	91,349,239 (GRCm39)	missense	probably benign	0.10
IGL01974:Per2	APN	1	91,351,440 (GRCm39)	missense	probably benign	0.02
IGL02118:Per2	APN	1	91,352,031 (GRCm39)	missense	probably damaging	0.99
IGL02271:Per2	APN	1	91,373,332 (GRCm39)	missense	probably damaging	1.00
IGL02533:Per2	APN	1	91,358,724 (GRCm39)	missense	possibly damaging	0.92
IGL02707:Per2	APN	1	91,378,450 (GRCm39)	missense	possibly damaging	0.94
IGL02972:Per2	APN	1	91,351,703 (GRCm39)	missense	possibly damaging	0.50
IGL03118:Per2	APN	1	91,372,341 (GRCm39)	nonsense	probably null
IGL03125:Per2	APN	1	91,378,333 (GRCm39)	missense	probably benign	0.00
IGL03375:Per2	APN	1	91,351,950 (GRCm39)	missense	possibly damaging	0.76
IGL03388:Per2	APN	1	91,372,511 (GRCm39)	splice site	probably benign
Kortiku	UTSW	1	91,351,551 (GRCm39)	missense	probably damaging	1.00
obst	UTSW	1	91,373,261 (GRCm39)	missense	probably benign	0.00
R7092_Per2_246	UTSW	1	91,349,153 (GRCm39)	missense	probably damaging	1.00
rhythm	UTSW	1	91,357,104 (GRCm39)	critical splice donor site	probably null
ANU23:Per2	UTSW	1	91,376,555 (GRCm39)	missense	probably damaging	0.98
R0029:Per2	UTSW	1	91,351,434 (GRCm39)	missense	possibly damaging	0.58
R0029:Per2	UTSW	1	91,351,434 (GRCm39)	missense	possibly damaging	0.58
R0542:Per2	UTSW	1	91,366,054 (GRCm39)	critical splice donor site	probably null
R0764:Per2	UTSW	1	91,357,142 (GRCm39)	missense	probably damaging	1.00
R1370:Per2	UTSW	1	91,373,279 (GRCm39)	missense	possibly damaging	0.94
R1655:Per2	UTSW	1	91,376,490 (GRCm39)	missense	probably damaging	1.00
R1688:Per2	UTSW	1	91,351,551 (GRCm39)	missense	probably damaging	1.00
R1997:Per2	UTSW	1	91,368,581 (GRCm39)	missense	probably damaging	1.00
R2893:Per2	UTSW	1	91,373,325 (GRCm39)	missense	probably damaging	1.00
R2894:Per2	UTSW	1	91,373,325 (GRCm39)	missense	probably damaging	1.00
R3109:Per2	UTSW	1	91,373,297 (GRCm39)	missense	probably benign	0.02
R4125:Per2	UTSW	1	91,357,172 (GRCm39)	missense	possibly damaging	0.71
R4997:Per2	UTSW	1	91,378,505 (GRCm39)	missense	probably benign	0.02
R5110:Per2	UTSW	1	91,357,237 (GRCm39)	missense	possibly damaging	0.57
R5478:Per2	UTSW	1	91,360,590 (GRCm39)	missense	probably benign	0.09
R5590:Per2	UTSW	1	91,355,578 (GRCm39)	nonsense	probably null
R5634:Per2	UTSW	1	91,372,429 (GRCm39)	missense	probably benign	0.02
R5654:Per2	UTSW	1	91,373,223 (GRCm39)	splice site	probably null
R5928:Per2	UTSW	1	91,372,373 (GRCm39)	missense	probably damaging	1.00
R6241:Per2	UTSW	1	91,349,251 (GRCm39)	missense	probably damaging	0.97
R6295:Per2	UTSW	1	91,377,594 (GRCm39)	missense	unknown
R6345:Per2	UTSW	1	91,376,444 (GRCm39)	missense	probably damaging	1.00
R6480:Per2	UTSW	1	91,357,104 (GRCm39)	critical splice donor site	probably null
R6502:Per2	UTSW	1	91,355,485 (GRCm39)	missense	probably benign	0.01
R6702:Per2	UTSW	1	91,355,671 (GRCm39)	missense	probably damaging	1.00
R6703:Per2	UTSW	1	91,355,671 (GRCm39)	missense	probably damaging	1.00
R6790:Per2	UTSW	1	91,373,261 (GRCm39)	missense	probably benign	0.00
R7043:Per2	UTSW	1	91,347,130 (GRCm39)	missense	probably benign
R7092:Per2	UTSW	1	91,349,153 (GRCm39)	missense	probably damaging	1.00
R7430:Per2	UTSW	1	91,351,705 (GRCm39)	nonsense	probably null
R7555:Per2	UTSW	1	91,362,857 (GRCm39)	missense	probably damaging	1.00
R7860:Per2	UTSW	1	91,372,481 (GRCm39)	missense	probably damaging	0.99
R8046:Per2	UTSW	1	91,363,425 (GRCm39)	missense	possibly damaging	0.56
R8142:Per2	UTSW	1	91,349,269 (GRCm39)	missense	possibly damaging	0.90
R8261:Per2	UTSW	1	91,361,170 (GRCm39)	missense	possibly damaging	0.87
R8277:Per2	UTSW	1	91,348,274 (GRCm39)	missense	probably benign	0.15
R8534:Per2	UTSW	1	91,351,659 (GRCm39)	missense	probably benign	0.09
R8685:Per2	UTSW	1	91,378,402 (GRCm39)	missense	possibly damaging	0.88
R8703:Per2	UTSW	1	91,351,767 (GRCm39)	missense	possibly damaging	0.92
R9100:Per2	UTSW	1	91,351,464 (GRCm39)	missense	possibly damaging	0.91
R9228:Per2	UTSW	1	91,366,081 (GRCm39)	missense	probably damaging	1.00
R9257:Per2	UTSW	1	91,376,445 (GRCm39)	missense	probably damaging	1.00
R9429:Per2	UTSW	1	91,351,489 (GRCm39)	missense	probably benign
X0011:Per2	UTSW	1	91,348,311 (GRCm39)	missense	possibly damaging	0.85
Z1176:Per2	UTSW	1	91,349,215 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGATCCGCCTCCTGACATTG -3'
(R):5'- CCTGTGCACCCTTATGACTTAAAG -3'

Sequencing Primer
(F):5'- GACATTGGACCAGCTGCCTTAC -3'
(R):5'- TTCCTAACAAAGGCCTGGTG -3'

Posted On

2015-01-23