Mutagenetix > Incidental Mutations

Incidental Mutation 'R0542:Per2'

49953

Institutional Source

Beutler Lab

Gene Symbol

Per2

Ensembl Gene

ENSMUSG00000055866

Gene Name

period circadian clock 2

Synonyms

mPer2

MMRRC Submission

038734-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R0542 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91415982-91459324 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 91438332 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000066620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069620]

Predicted Effect

probably null
Transcript: ENSMUST00000069620

SMART Domains

Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866

Domain	Start	End	E-Value	Type
PAS	179	246	3.23e1	SMART
PAS	319	385	5.75e-2	SMART
PAC	393	436	1.6e0	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	821	834	N/A	INTRINSIC
low complexity region	996	1014	N/A	INTRINSIC
Pfam:Period_C	1040	1234	2.7e-93	PFAM

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	A	G	2: 148,782,172	N22S	probably benign	Het
Abhd12b	C	A	12: 70,163,495	N71K	possibly damaging	Het
Adgrl2	A	G	3: 148,859,218	I242T	probably damaging	Het
Adgrv1	A	G	13: 81,573,318	S714P	probably damaging	Het
Agap3	G	A	5: 24,500,186	R704Q	possibly damaging	Het
Ankrd11	T	C	8: 122,895,770	R448G	probably damaging	Het
Anks1b	T	C	10: 90,073,967		probably benign	Het
Caml	A	T	13: 55,623,161	Q24L	possibly damaging	Het
Cdc14b	G	A	13: 64,243,683	T124I	probably benign	Het
Clca2	A	G	3: 145,075,810		probably benign	Het
Col12a1	A	G	9: 79,605,328		probably null	Het
Crispld1	T	C	1: 17,746,768	V183A	possibly damaging	Het
Dhx40	C	T	11: 86,804,256		probably null	Het
Dmxl1	T	A	18: 49,893,694	D1956E	probably benign	Het
Dsc2	A	G	18: 20,051,226	V35A	probably damaging	Het
Dusp27	A	T	1: 166,101,284	M253K	possibly damaging	Het
Elovl2	A	G	13: 41,191,976		probably benign	Het
Gapvd1	T	C	2: 34,725,036		probably benign	Het
Gnaq	T	A	19: 16,219,618	I56N	probably damaging	Het
Gpr139	T	C	7: 119,145,083	D93G	probably benign	Het
Hars	C	T	18: 36,771,181	R215H	probably benign	Het
Helz2	C	A	2: 181,232,089	W2204L	probably damaging	Het
Itgb6	A	T	2: 60,605,136	C757S	possibly damaging	Het
Kpnb1	G	A	11: 97,187,572	T5I	probably benign	Het
Krt82	T	C	15: 101,545,600		probably benign	Het
Lgals9	T	A	11: 78,969,720	K175N	possibly damaging	Het
Lrp2	A	G	2: 69,428,654	I4564T	probably benign	Het
Mblac1	A	G	5: 138,194,536	T47A	possibly damaging	Het
Med12l	G	A	3: 59,042,401	D182N	probably damaging	Het
Megf9	A	G	4: 70,435,348	I407T	probably benign	Het
Mtmr6	A	T	14: 60,292,129		probably null	Het
Mtor	A	G	4: 148,540,450	T2173A	probably benign	Het
Mzt1	A	T	14: 99,040,502		probably benign	Het
Narf	T	C	11: 121,252,864	L444P	probably damaging	Het
Nsd1	A	T	13: 55,260,458	Q1305L	possibly damaging	Het
Ntsr1	A	G	2: 180,542,581	Y359C	probably damaging	Het
Olfm1	A	G	2: 28,214,628	D159G	possibly damaging	Het
Olfr168	A	T	16: 19,529,982	*313R	probably null	Het
Pcdh1	C	T	18: 38,189,922	V953I	probably damaging	Het
Pcdhb11	A	T	18: 37,423,834	D739V	probably damaging	Het
Pdgfd	A	G	9: 6,359,769	N280S	probably damaging	Het
Pfkp	G	T	13: 6,621,992	C122*	probably null	Het
Plxna4	G	A	6: 32,192,297	R1322W	probably damaging	Het
Ppox	A	G	1: 171,279,244	L202P	probably damaging	Het
Ppp1r3e	G	A	14: 54,877,131	P58L	probably benign	Het
Prr23a2	A	C	9: 98,857,033	N148T	probably benign	Het
Psd	T	C	19: 46,314,210	T842A	probably damaging	Het
Ranbp2	C	T	10: 58,478,414	A1652V	probably benign	Het
Rragd	G	A	4: 33,007,103	V144M	probably damaging	Het
Sema6a	T	G	18: 47,248,576	D968A	probably damaging	Het
Slc30a5	A	T	13: 100,809,285		probably null	Het
Snx17	G	T	5: 31,196,551		probably null	Het
Syt14	G	T	1: 192,930,803	T563K	probably damaging	Het
Tada3	T	C	6: 113,375,214	K85E	probably damaging	Het
Tspear	T	C	10: 77,881,087	V532A	probably benign	Het
Ttc30b	A	G	2: 75,936,711	V566A	probably damaging	Het
Ttn	A	T	2: 76,893,109	C6426S	possibly damaging	Het
Unc79	T	C	12: 103,094,178		probably benign	Het
Usp19	A	G	9: 108,494,385		probably null	Het
Vav3	G	A	3: 109,527,430	D426N	probably damaging	Het
Vezt	T	C	10: 94,007,096		probably null	Het
Vldlr	G	T	19: 27,236,255	R114L	probably benign	Het
Wdr34	A	G	2: 30,031,825	V508A	probably damaging	Het
Wwc2	C	T	8: 47,868,379	V567I	unknown	Het
Zfp423	T	C	8: 87,780,609	T911A	probably damaging	Het
Zfp719	A	G	7: 43,589,253		probably null	Het
Zkscan16	A	T	4: 58,956,597	H293L	possibly damaging	Het
Zkscan6	A	C	11: 65,828,699	N515T	possibly damaging	Het
Znfx1	A	G	2: 167,055,655	S450P	probably damaging	Het

Other mutations in Per2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Per2	APN	1	91448833	missense	probably damaging	0.98
IGL01350:Per2	APN	1	91430861	missense	probably damaging	1.00
IGL01865:Per2	APN	1	91421517	missense	probably benign	0.10
IGL01974:Per2	APN	1	91423718	missense	probably benign	0.02
IGL02118:Per2	APN	1	91424309	missense	probably damaging	0.99
IGL02271:Per2	APN	1	91445610	missense	probably damaging	1.00
IGL02533:Per2	APN	1	91431002	missense	possibly damaging	0.92
IGL02707:Per2	APN	1	91450728	missense	possibly damaging	0.94
IGL02972:Per2	APN	1	91423981	missense	possibly damaging	0.50
IGL03118:Per2	APN	1	91444619	nonsense	probably null
IGL03125:Per2	APN	1	91450611	missense	probably benign	0.00
IGL03375:Per2	APN	1	91424228	missense	possibly damaging	0.76
IGL03388:Per2	APN	1	91444789	splice site	probably benign
Kortiku	UTSW	1	91423829	missense	probably damaging	1.00
obst	UTSW	1	91445539	missense	probably benign	0.00
rhythm	UTSW	1	91429382	critical splice donor site	probably null
ANU23:Per2	UTSW	1	91448833	missense	probably damaging	0.98
R0029:Per2	UTSW	1	91423712	missense	possibly damaging	0.58
R0029:Per2	UTSW	1	91423712	missense	possibly damaging	0.58
R0764:Per2	UTSW	1	91429420	missense	probably damaging	1.00
R1370:Per2	UTSW	1	91445557	missense	possibly damaging	0.94
R1655:Per2	UTSW	1	91448768	missense	probably damaging	1.00
R1688:Per2	UTSW	1	91423829	missense	probably damaging	1.00
R1997:Per2	UTSW	1	91440859	missense	probably damaging	1.00
R2891:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R2893:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R2894:Per2	UTSW	1	91445603	missense	probably damaging	1.00
R3109:Per2	UTSW	1	91445575	missense	probably benign	0.02
R4125:Per2	UTSW	1	91429450	missense	possibly damaging	0.71
R4997:Per2	UTSW	1	91450783	missense	probably benign	0.02
R5110:Per2	UTSW	1	91429515	missense	possibly damaging	0.57
R5478:Per2	UTSW	1	91432868	missense	probably benign	0.09
R5590:Per2	UTSW	1	91427856	nonsense	probably null
R5634:Per2	UTSW	1	91444707	missense	probably benign	0.02
R5654:Per2	UTSW	1	91445501	splice site	probably null
R5928:Per2	UTSW	1	91444651	missense	probably damaging	1.00
R6241:Per2	UTSW	1	91421529	missense	probably damaging	0.97
R6295:Per2	UTSW	1	91449872	missense	unknown
R6345:Per2	UTSW	1	91448722	missense	probably damaging	1.00
R6480:Per2	UTSW	1	91429382	critical splice donor site	probably null
R6502:Per2	UTSW	1	91427763	missense	probably benign	0.01
R6702:Per2	UTSW	1	91427949	missense	probably damaging	1.00
R6703:Per2	UTSW	1	91427949	missense	probably damaging	1.00
R6790:Per2	UTSW	1	91445539	missense	probably benign	0.00
R7043:Per2	UTSW	1	91419408	missense	probably benign
R7092:Per2	UTSW	1	91421431	missense	probably damaging	1.00
R7430:Per2	UTSW	1	91423983	nonsense	probably null
R7555:Per2	UTSW	1	91435135	missense	probably damaging	1.00
R7860:Per2	UTSW	1	91444759	missense	probably damaging	0.99
R8046:Per2	UTSW	1	91435703	missense	possibly damaging	0.56
R8142:Per2	UTSW	1	91421547	missense	possibly damaging	0.90
R8261:Per2	UTSW	1	91433448	missense	possibly damaging	0.87
R8277:Per2	UTSW	1	91420552	missense	probably benign	0.15
R8534:Per2	UTSW	1	91423937	missense	probably benign	0.09
X0011:Per2	UTSW	1	91420589	missense	possibly damaging	0.85
Z1176:Per2	UTSW	1	91421493	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGACCGAAGCATCACTGTGTCAC -3'
(R):5'- GCTCCCAGAGAAGTTAAAGAGGCTG -3'

Sequencing Primer
(F):5'- TGTGTCACAGAATAGCACAGTC -3'
(R):5'- CCTTCAGCATGGTGGCTC -3'

Posted On

2013-06-12