Incidental Mutation 'R2880:Lrit1'
ID260295
Institutional Source Beutler Lab
Gene Symbol Lrit1
Ensembl Gene ENSMUSG00000041044
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 1
SynonymsLrrc21
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location37054830-37064946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37057437 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 109 (L109Q)
Ref Sequence ENSEMBL: ENSMUSP00000113964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120052]
Predicted Effect probably damaging
Transcript: ENSMUST00000120052
AA Change: L109Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113964
Gene: ENSMUSG00000041044
AA Change: L109Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 22 63 1.97e-3 SMART
LRR 82 105 1.03e1 SMART
LRR 106 129 3e1 SMART
LRR 130 152 1.12e1 SMART
LRR_TYP 154 177 4.47e-3 SMART
LRRCT 201 253 2.04e-7 SMART
IGc2 267 336 6.55e-8 SMART
FN3 429 506 2.22e0 SMART
transmembrane domain 531 553 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic communication of cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Lrit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Lrit1 APN 14 37060155 missense probably damaging 0.98
IGL01676:Lrit1 APN 14 37057437 missense probably damaging 1.00
IGL02011:Lrit1 APN 14 37062323 missense probably damaging 1.00
PIT4142001:Lrit1 UTSW 14 37062041 missense probably damaging 1.00
R0194:Lrit1 UTSW 14 37061720 missense probably damaging 1.00
R0348:Lrit1 UTSW 14 37060225 missense probably damaging 1.00
R1444:Lrit1 UTSW 14 37061971 missense probably benign
R1500:Lrit1 UTSW 14 37062134 missense probably benign 0.23
R1884:Lrit1 UTSW 14 37061753 missense possibly damaging 0.94
R4784:Lrit1 UTSW 14 37062236 missense possibly damaging 0.79
R4855:Lrit1 UTSW 14 37061816 missense possibly damaging 0.75
R5100:Lrit1 UTSW 14 37062214 missense possibly damaging 0.74
R5365:Lrit1 UTSW 14 37062142 missense probably benign 0.00
R5474:Lrit1 UTSW 14 37061986 missense probably benign
R5475:Lrit1 UTSW 14 37055001 missense probably benign 0.00
R5614:Lrit1 UTSW 14 37061954 missense probably benign 0.39
R5688:Lrit1 UTSW 14 37062428 missense possibly damaging 0.66
R5926:Lrit1 UTSW 14 37055009 missense probably damaging 1.00
R6063:Lrit1 UTSW 14 37054988 missense probably benign 0.05
R6920:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6940:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6941:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6943:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6945:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6957:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6958:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6959:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6960:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6962:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R7784:Lrit1 UTSW 14 37061780 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATTTCTGTGACCAGGACAG -3'
(R):5'- CTCATCAGCTGGTTATTGGACAGG -3'

Sequencing Primer
(F):5'- AGCGACCCTGACTTGACTCTG -3'
(R):5'- GTCCAGGAAAGTAAGGTTCTCC -3'
Posted On2015-01-23