Incidental Mutation 'R2876:Gm38394'
ID260538
Institutional Source Beutler Lab
Gene Symbol Gm38394
Ensembl Gene ENSMUSG00000094410
Gene Namepredicted gene, 38394
Synonyms
MMRRC Submission 040464-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133619940-133661318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133656860 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 913 (C913Y)
Ref Sequence ENSEMBL: ENSMUSP00000140892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000190574] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195424] [ENSMUST00000195067]
Predicted Effect probably benign
Transcript: ENSMUST00000027736
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179598
AA Change: C913Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410
AA Change: C913Y

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186476
AA Change: C913Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410
AA Change: C913Y

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190574
AA Change: C913Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140892
Gene: ENSMUSG00000102049
AA Change: C913Y

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191705
Predicted Effect probably benign
Transcript: ENSMUST00000191896
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192775
Predicted Effect probably benign
Transcript: ENSMUST00000193504
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194668
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195424
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195067
Meta Mutation Damage Score 0.4267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Gm38394
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0385:Gm38394 UTSW 1 133656784 missense probably damaging 0.99
R0417:Gm38394 UTSW 1 133658538 missense probably benign
R0526:Gm38394 UTSW 1 133658734 missense probably damaging 0.99
R0576:Gm38394 UTSW 1 133657838 missense probably benign 0.37
R1164:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1187:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1415:Gm38394 UTSW 1 133657818 missense possibly damaging 0.80
R1997:Gm38394 UTSW 1 133656713 missense probably damaging 1.00
R2186:Gm38394 UTSW 1 133658079 missense probably damaging 1.00
R2875:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2975:Gm38394 UTSW 1 133658237 missense probably damaging 0.99
R4573:Gm38394 UTSW 1 133659389 missense probably benign 0.00
R4631:Gm38394 UTSW 1 133658744 missense probably damaging 1.00
R4671:Gm38394 UTSW 1 133657040 missense probably benign
R4976:Gm38394 UTSW 1 133658094 missense probably benign 0.27
R5048:Gm38394 UTSW 1 133658724 missense probably damaging 0.99
R5318:Gm38394 UTSW 1 133658115 missense possibly damaging 0.86
R5400:Gm38394 UTSW 1 133658141 missense probably damaging 1.00
R5427:Gm38394 UTSW 1 133657595 missense possibly damaging 0.83
R6530:Gm38394 UTSW 1 133659201 missense probably damaging 1.00
R7511:Gm38394 UTSW 1 133659243 missense probably benign 0.30
R8215:Gm38394 UTSW 1 133658792 missense probably damaging 1.00
Z1177:Gm38394 UTSW 1 133659116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCCCATTTTAAGTAGGACAAG -3'
(R):5'- GCTGTTGGGAGCAAAAGCTC -3'

Sequencing Primer
(F):5'- GCTCTGAACAGCCTTATTTTCAGGG -3'
(R):5'- CTCCTTGCTCCCCGCTG -3'
Posted On2015-01-23