Incidental Mutation 'R2884:Mtnr1a'
ID260965
Institutional Source Beutler Lab
Gene Symbol Mtnr1a
Ensembl Gene ENSMUSG00000054764
Gene Namemelatonin receptor 1A
SynonymsMelR, Mel1a receptor
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45069137-45088506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45087268 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 89 (T89A)
Ref Sequence ENSEMBL: ENSMUSP00000069872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067984]
Predicted Effect probably benign
Transcript: ENSMUST00000067984
AA Change: T89A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069872
Gene: ENSMUSG00000054764
AA Change: T89A

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 315 1.8e-11 PFAM
Pfam:7TM_GPCR_Srsx 41 313 2.5e-10 PFAM
Pfam:7tm_1 47 298 5.6e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130141
AA Change: T63A
SMART Domains Protein: ENSMUSP00000115764
Gene: ENSMUSG00000054764
AA Change: T63A

DomainStartEndE-ValueType
Pfam:7tm_1 23 92 6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209488
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is readily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal, with normal circadian functions. In vitro studies report the absence of inhibitory effects of melatonin on suprachiasma neuronal firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Mtnr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Mtnr1a APN 8 45069382 missense probably damaging 0.97
IGL03230:Mtnr1a APN 8 45087398 missense probably damaging 1.00
R0149:Mtnr1a UTSW 8 45069315 missense probably benign
R0744:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0833:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0836:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0856:Mtnr1a UTSW 8 45087833 missense possibly damaging 0.86
R1445:Mtnr1a UTSW 8 45087745 missense probably benign 0.27
R1983:Mtnr1a UTSW 8 45087434 missense probably benign 0.01
R2444:Mtnr1a UTSW 8 45087658 nonsense probably null
R3947:Mtnr1a UTSW 8 45087520 missense probably damaging 1.00
R4829:Mtnr1a UTSW 8 45085615 intron probably benign
R5681:Mtnr1a UTSW 8 45087937 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTTCCCTTTCTTTAGCATATGGAAG -3'
(R):5'- ACACGTAGCAGAGCGAGTTC -3'

Sequencing Primer
(F):5'- CACTTGCTCTAGGACTATAGGCAG -3'
(R):5'- AGCAGAGCGAGTTCTTGTTAC -3'
Posted On2015-01-23