Incidental Mutation 'R2884:Myh13'
ID260976
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission 040472-MU
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67337643 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 336 (N336K)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably benign
Transcript: ENSMUST00000081911
AA Change: N336K

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: N336K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
AA Change: N336K

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: N336K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
AA Change: N336K

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: N336K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
Predicted Primers PCR Primer
(F):5'- TGGGAGAGGTTACAGCTAGTTC -3'
(R):5'- AACATGGGTAAGGAATCAAATCCC -3'

Sequencing Primer
(F):5'- GGAGAGGTTACAGCTAGTTCTTATC -3'
(R):5'- CCCCTCTCTCCCTGCTCAG -3'
Posted On2015-01-23