Incidental Mutation 'R2884:Nprl3'
ID260975
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Namenitrogen permease regulator-like 3
SynonymsProx1, HS-26, Phg, -14 gene, HS-40, Mare, m(alpha)RE
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location32225628-32267707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32248163 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 179 (L179P)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000129010] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000149526]
Predicted Effect probably damaging
Transcript: ENSMUST00000020530
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: L204P

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109389
AA Change: L179P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: L179P

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123411
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127657
Predicted Effect probably benign
Transcript: ENSMUST00000129010
SMART Domains Protein: ENSMUSP00000123219
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 3e-29 BLAST
Pfam:NPR3 76 131 3e-16 PFAM
Pfam:NPR3 114 182 3.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32267539 start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32248230 intron probably benign
IGL03366:Nprl3 APN 11 32250256 missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32239784 unclassified probably benign
R0555:Nprl3 UTSW 11 32233118 critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32234876 missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32232973 missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32234894 missense probably benign 0.00
R3713:Nprl3 UTSW 11 32255464 missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32233082 missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32234906 missense probably benign 0.00
R6052:Nprl3 UTSW 11 32255453 missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32267432 missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32239828 missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32234812 missense probably benign
R6585:Nprl3 UTSW 11 32234812 missense probably benign
R6774:Nprl3 UTSW 11 32237381 missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32267509 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTTCCTGAAAAGTGGCCAC -3'
(R):5'- GATGATGACAAGGGATTTTCTGATG -3'

Sequencing Primer
(F):5'- GTGGCCACACAAGTGTCC -3'
(R):5'- CTTGCTTTGGAAGTTGTAAATC -3'
Posted On2015-01-23