Incidental Mutation 'R2884:Nprl3'
ID 260975
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 040472-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R2884 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32198163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 179 (L179P)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000136903] [ENSMUST00000129010] [ENSMUST00000141859] [ENSMUST00000149526] [ENSMUST00000137950]
AlphaFold Q8VIJ8
Predicted Effect probably damaging
Transcript: ENSMUST00000020530
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: L204P

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109389
AA Change: L179P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: L179P

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123411
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000129010
SMART Domains Protein: ENSMUSP00000123219
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 3e-29 BLAST
Pfam:NPR3 76 131 3e-16 PFAM
Pfam:NPR3 114 182 3.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,872,250 (GRCm39) E59D possibly damaging Het
Arhgap27 T C 11: 103,251,669 (GRCm39) probably null Het
BC061237 A G 14: 44,738,627 (GRCm39) R9G possibly damaging Het
Brsk1 A G 7: 4,694,122 (GRCm39) probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cspg4b G T 13: 113,505,725 (GRCm39) A2285S probably benign Het
Cspg4b A T 13: 113,457,216 (GRCm39) Q1087H probably damaging Het
Dnajb5 A T 4: 42,957,355 (GRCm39) D284V probably damaging Het
Dnmt3a A G 12: 3,946,132 (GRCm39) D329G probably damaging Het
Ecd C T 14: 20,370,841 (GRCm39) G626D probably damaging Het
Exoc3l4 A G 12: 111,394,956 (GRCm39) D551G possibly damaging Het
Fam227b A T 2: 125,942,846 (GRCm39) I317N probably benign Het
Fam3c G A 6: 22,329,581 (GRCm39) R49C probably damaging Het
Fcrl5 A G 3: 87,364,698 (GRCm39) Y566C probably damaging Het
Fras1 A G 5: 96,848,127 (GRCm39) N1779S probably benign Het
Gm19965 T A 1: 116,749,313 (GRCm39) N331K probably benign Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
H2ac8 A G 13: 23,755,047 (GRCm39) I79T probably damaging Het
H2-DMa A G 17: 34,356,121 (GRCm39) N41S probably damaging Het
Habp4 A T 13: 64,330,080 (GRCm39) R328S probably benign Het
Hexb C T 13: 97,320,208 (GRCm39) G272D probably damaging Het
Lilrb4a A T 10: 51,367,709 (GRCm39) N84Y probably benign Het
Mtnr1a A G 8: 45,540,305 (GRCm39) T89A probably benign Het
Myh13 T A 11: 67,228,469 (GRCm39) N336K probably benign Het
Naca T C 10: 127,877,547 (GRCm39) probably benign Het
Naif1 C T 2: 32,344,887 (GRCm39) P197L probably benign Het
Nup93 A G 8: 95,030,266 (GRCm39) Y375C probably damaging Het
Or52b4 A G 7: 102,184,439 (GRCm39) I162V probably benign Het
Pcdha12 G A 18: 37,153,757 (GRCm39) D159N probably damaging Het
Plekhs1 G A 19: 56,459,258 (GRCm39) G39R probably benign Het
Ppp4r3a T C 12: 101,034,936 (GRCm39) E53G probably damaging Het
Prss48 A T 3: 85,904,562 (GRCm39) M212K probably benign Het
Pth A T 7: 112,985,235 (GRCm39) L46Q probably damaging Het
Rin2 A T 2: 145,702,911 (GRCm39) T536S probably benign Het
Setx T G 2: 29,038,637 (GRCm39) C1707W probably damaging Het
Stau2 A T 1: 16,301,290 (GRCm39) F519Y possibly damaging Het
Syne2 T G 12: 76,010,533 (GRCm39) V2481G probably benign Het
Tpte C T 8: 22,825,439 (GRCm39) Q331* probably null Het
Ttn G T 2: 76,730,596 (GRCm39) probably benign Het
Utrn A T 10: 12,615,105 (GRCm39) probably null Het
Vmn2r82 A G 10: 79,232,082 (GRCm39) I694V probably benign Het
Vmn2r88 G A 14: 51,651,391 (GRCm39) C235Y probably damaging Het
Xrn2 T A 2: 146,889,576 (GRCm39) V653E probably damaging Het
Znrf3 A T 11: 5,239,693 (GRCm39) D58E probably damaging Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTTCCTGAAAAGTGGCCAC -3'
(R):5'- GATGATGACAAGGGATTTTCTGATG -3'

Sequencing Primer
(F):5'- GTGGCCACACAAGTGTCC -3'
(R):5'- CTTGCTTTGGAAGTTGTAAATC -3'
Posted On 2015-01-23