Incidental Mutation 'R2869:Tnni3k'
ID266427
Institutional Source Beutler Lab
Gene Symbol Tnni3k
Ensembl Gene ENSMUSG00000040086
Gene NameTNNI3 interacting kinase
SynonymsCark, D830019J24Rik
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location154786291-155055407 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 154938750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]
Predicted Effect probably null
Transcript: ENSMUST00000064076
SMART Domains Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 718 6.7e-48 PFAM
Pfam:Pkinase_Tyr 462 718 2.1e-59 PFAM
low complexity region 727 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143410
SMART Domains Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 674 3.5e-48 PFAM
Pfam:Pkinase_Tyr 462 674 3.6e-52 PFAM
Meta Mutation Damage Score 0.9715 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Carmil1 G A 13: 24,045,068 silent Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gm26902 T A 19: 34,474,810 H106L probably benign Het
Gm37340 G A 2: 6,950,928 probably benign Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Habp2 T A 19: 56,287,991 probably benign Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
March8 C T 6: 116,401,145 probably benign Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Tnni3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Tnni3k APN 3 155054555 missense probably benign 0.00
IGL00852:Tnni3k APN 3 155054569 missense probably benign 0.00
IGL01090:Tnni3k APN 3 154939683 missense possibly damaging 0.69
IGL01593:Tnni3k APN 3 154941029 splice site probably null
IGL01724:Tnni3k APN 3 154939626 missense possibly damaging 0.53
IGL01887:Tnni3k APN 3 154875187 splice site probably null
IGL01992:Tnni3k APN 3 154962026 missense probably damaging 0.99
IGL02945:Tnni3k APN 3 155037438 missense possibly damaging 0.48
IGL02990:Tnni3k APN 3 154957758 missense probably benign 0.01
IGL03069:Tnni3k APN 3 154941605 splice site probably null
IGL03325:Tnni3k APN 3 154961814 missense probably damaging 1.00
IGL03405:Tnni3k APN 3 154792767 splice site probably benign
R0211:Tnni3k UTSW 3 155055344 start gained probably benign
R0682:Tnni3k UTSW 3 154940028 missense probably damaging 1.00
R0693:Tnni3k UTSW 3 154961972 missense probably damaging 1.00
R0907:Tnni3k UTSW 3 154941679 missense probably damaging 1.00
R1109:Tnni3k UTSW 3 154792777 missense possibly damaging 0.83
R1180:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1181:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1476:Tnni3k UTSW 3 155030305 missense probably benign 0.05
R1496:Tnni3k UTSW 3 154939658 missense probably damaging 1.00
R1687:Tnni3k UTSW 3 154939626 missense possibly damaging 0.53
R1704:Tnni3k UTSW 3 154827508 missense probably benign 0.27
R1913:Tnni3k UTSW 3 154979199 missense probably benign 0.00
R2343:Tnni3k UTSW 3 154938829 missense probably benign 0.00
R2374:Tnni3k UTSW 3 154786785 missense probably benign 0.12
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2873:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R4858:Tnni3k UTSW 3 154786808 splice site probably null
R5597:Tnni3k UTSW 3 154872128 missense probably damaging 1.00
R5806:Tnni3k UTSW 3 154827611 missense possibly damaging 0.88
R5871:Tnni3k UTSW 3 155030370 missense probably benign 0.23
R6467:Tnni3k UTSW 3 154969285 missense probably damaging 0.97
R6475:Tnni3k UTSW 3 154941058 nonsense probably null
R6882:Tnni3k UTSW 3 154957720 missense possibly damaging 0.49
R6976:Tnni3k UTSW 3 154792776 missense probably benign 0.14
R6986:Tnni3k UTSW 3 154961864 missense probably damaging 1.00
R7207:Tnni3k UTSW 3 154875145 missense probably damaging 1.00
R7539:Tnni3k UTSW 3 154962031 missense probably benign 0.01
R7843:Tnni3k UTSW 3 155038524 missense probably damaging 0.98
R7926:Tnni3k UTSW 3 155038524 missense probably damaging 0.98
Z1088:Tnni3k UTSW 3 154939670 missense probably damaging 1.00
Z1176:Tnni3k UTSW 3 155038557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAACAGTCTGTCCTTGATG -3'
(R):5'- AAAACATCACGGGGTGTTTTC -3'

Sequencing Primer
(F):5'- TAGATTTCCACGGTCCCTGAGAG -3'
(R):5'- AAAACATCACGGGGTGTTTTCTTTTG -3'
Posted On2015-02-18