Mutagenetix > Incidental Mutations

Incidental Mutation 'R3547:Pi4k2a'

268277

Institutional Source

Beutler Lab

Gene Symbol

Pi4k2a

Ensembl Gene

ENSMUSG00000025178

Gene Name

phosphatidylinositol 4-kinase type 2 alpha

Synonyms

MMRRC Submission

040666-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R3547 (G1)

Quality Score

115

Status

Validated

Chromosome

Chromosomal Location

42090435-42122218 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 42090548 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 16 (P16L)

Ref Sequence

ENSEMBL: ENSMUSP00000069284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051772] [ENSMUST00000066778]

Predicted Effect

probably benign
Transcript: ENSMUST00000051772

SMART Domains

Protein: ENSMUSP00000062887
Gene: ENSMUSG00000049670

Domain	Start	End	E-Value	Type
MORN	14	35	1.64e-5	SMART
MORN	37	58	4.15e-2	SMART
MORN	60	81	1.86e-4	SMART
MORN	83	104	1.84e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000066778
AA Change: P16L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178
AA Change: P16L

Domain	Start	End	E-Value	Type
low complexity region	31	53	N/A	INTRINSIC
low complexity region	68	98	N/A	INTRINSIC
Pfam:PI3_PI4_kinase	133	431	1.7e-67	PFAM

Meta Mutation Damage Score

0.0862

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele develop a progressive neurologic disease typified by urinary incontinence, tremor, limb weakness, weight loss, cerebellar gliosis, Purkinje cell loss, degeneration of spinal cord axons and premature death. Mutant males are sterile while females are subfertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109I03Rik	C	A	15: 74,881,614	A18S	probably null	Het
Alg5	A	G	3: 54,749,315	R316G	probably benign	Het
Anapc1	T	C	2: 128,642,682	N1121D	possibly damaging	Het
Antxr2	A	T	5: 97,977,657	I247N	probably benign	Het
Arid5b	C	T	10: 68,098,462	G294S	probably benign	Het
Arl9	A	G	5: 77,010,479	D136G	probably benign	Het
Atxn1l	A	G	8: 109,732,349	L427P	possibly damaging	Het
Celf3	T	G	3: 94,488,538	C304G	probably damaging	Het
Clcc1	T	A	3: 108,668,113	C169S	probably benign	Het
Clec4a3	A	G	6: 122,964,280	E78G	probably damaging	Het
Clip1	A	G	5: 123,631,078	L532P	probably damaging	Het
Col12a1	T	G	9: 79,633,416	K2429T	probably damaging	Het
Col20a1	G	T	2: 180,994,911	E228D	probably damaging	Het
Cx3cl1	A	C	8: 94,778,124	E56A	possibly damaging	Het
Eprs	G	A	1: 185,379,742		probably null	Het
Fap	A	C	2: 62,519,011	L478R	probably damaging	Het
Fhit	T	C	14: 9,870,095	T125A	probably benign	Het
Gdi1	T	A	X: 74,307,808	F175L	possibly damaging	Het
Golga7b	T	C	19: 42,267,071	M129T	possibly damaging	Het
Gpr149	A	T	3: 62,595,128	C436S	probably benign	Het
Grid2	T	C	6: 64,320,021	V456A	probably damaging	Het
Gstcd	G	T	3: 133,084,838	T56K	possibly damaging	Het
Hydin	G	A	8: 110,582,067	G3995D	possibly damaging	Het
Igkv4-50	G	A	6: 69,700,781	T113I	probably benign	Het
Igkv5-45	A	G	6: 69,776,256		probably benign	Het
Igsf10	G	A	3: 59,330,541	H740Y	probably benign	Het
Igsf10	C	A	3: 59,336,514	R133L	probably damaging	Het
Lcmt1	A	G	7: 123,400,479	E94G	probably benign	Het
Lrp1b	A	T	2: 40,600,288	L287H	probably damaging	Het
Map3k3	C	T	11: 106,142,553	Q211*	probably null	Het
Map4	T	A	9: 110,052,198	F43L	possibly damaging	Het
Mcf2	T	C	X: 60,135,446	K74R	probably damaging	Het
Mylk	G	A	16: 34,880,168	V460I	possibly damaging	Het
Nat1	A	G	8: 67,491,032	D23G	possibly damaging	Het
Nbeal1	T	C	1: 60,278,780	F1959L	probably damaging	Het
Ncf1	T	A	5: 134,226,609	K143*	probably null	Het
Nlrp6	T	G	7: 140,926,769	V849G	probably benign	Het
Olfr549	A	G	7: 102,554,470	Y62C	probably damaging	Het
Pitx3	T	A	19: 46,136,109	Q273L	possibly damaging	Het
Ppp1r27	T	A	11: 120,550,685	I90F	probably damaging	Het
Prickle2	T	C	6: 92,411,137	Y428C	probably damaging	Het
Prkcq	A	G	2: 11,283,816	K527E	probably benign	Het
Prune2	T	A	19: 17,124,348	S2405R	probably damaging	Het
Reln	A	G	5: 22,227,600	V134A	possibly damaging	Het
Rnf167	T	C	11: 70,649,681	I129T	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sfxn2	T	C	19: 46,590,196	S217P	probably damaging	Het
Slc16a7	T	A	10: 125,294,700	K39*	probably null	Het
Slc22a17	A	G	14: 54,907,237	L573P	probably damaging	Het
Slc25a45	T	C	19: 5,884,546	Y181H	probably damaging	Het
Slc6a20a	A	G	9: 123,660,502	S159P	probably damaging	Het
Tbc1d1	G	A	5: 64,286,007	R523Q	probably damaging	Het
Thnsl1	T	G	2: 21,212,627	D397E	probably benign	Het
Ttn	T	A	2: 76,745,106	I25148F	probably damaging	Het
Ube4b	T	C	4: 149,335,116	D1045G	probably damaging	Het
Ugt8a	A	T	3: 125,867,382	L487*	probably null	Het
Uprt	T	A	X: 104,483,328	L123H	probably damaging	Het
Usp9x	T	C	X: 13,128,390	L940P	probably benign	Het
Utp20	T	C	10: 88,782,689	K1150E	probably damaging	Het
Uty	A	C	Y: 1,158,512	D463E	possibly damaging	Het
Vmn1r7	A	G	6: 57,024,849	I142T	possibly damaging	Het
Vps13d	T	G	4: 145,074,975	T3558P	probably damaging	Het
Zfp319	A	G	8: 95,328,817	S253P	probably damaging	Het
Zfp831	A	G	2: 174,657,683	S1265G	probably benign	Het

Other mutations in Pi4k2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01710:Pi4k2a	APN	19	42104979	missense	probably damaging	1.00
IGL02959:Pi4k2a	APN	19	42113071	missense	probably benign	0.42
R1570:Pi4k2a	UTSW	19	42100644	missense	probably benign	0.33
R1992:Pi4k2a	UTSW	19	42115938	missense	probably damaging	1.00
R2113:Pi4k2a	UTSW	19	42115071	missense	possibly damaging	0.78
R2358:Pi4k2a	UTSW	19	42090692	missense	probably damaging	0.99
R2410:Pi4k2a	UTSW	19	42104877	missense	possibly damaging	0.55
R3708:Pi4k2a	UTSW	19	42090931	nonsense	probably null
R3712:Pi4k2a	UTSW	19	42090692	missense	probably damaging	0.99
R3954:Pi4k2a	UTSW	19	42115899	missense	probably damaging	0.98
R4654:Pi4k2a	UTSW	19	42113105	critical splice donor site	probably null
R5077:Pi4k2a	UTSW	19	42119836	unclassified	probably null
R5386:Pi4k2a	UTSW	19	42090515	missense	probably damaging	0.99
R5846:Pi4k2a	UTSW	19	42115038	missense	probably benign	0.01
R5867:Pi4k2a	UTSW	19	42105485	critical splice donor site	probably null
R5878:Pi4k2a	UTSW	19	42100641	missense	probably benign	0.02
R6502:Pi4k2a	UTSW	19	42090932	missense	probably benign	0.04
R7042:Pi4k2a	UTSW	19	42104898	missense	probably benign	0.18
R7269:Pi4k2a	UTSW	19	42090686	missense	probably damaging	1.00
R7819:Pi4k2a	UTSW	19	42090574	missense	probably benign
Z1177:Pi4k2a	UTSW	19	42104925	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCGCCAAGTAAACAGGACAG -3'
(R):5'- TAGATGCTGCACTCGATGG -3'

Sequencing Primer
(F):5'- CCAAGTAAACAGGACAGGCTAG -3'
(R):5'- TGCACTCGATGGCAACCTC -3'

Posted On

2015-02-19