Incidental Mutation 'R3547:Pi4k2a'
ID268277
Institutional Source Beutler Lab
Gene Symbol Pi4k2a
Ensembl Gene ENSMUSG00000025178
Gene Namephosphatidylinositol 4-kinase type 2 alpha
Synonyms
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R3547 (G1)
Quality Score115
Status Validated
Chromosome19
Chromosomal Location42090435-42122218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42090548 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 16 (P16L)
Ref Sequence ENSEMBL: ENSMUSP00000069284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051772] [ENSMUST00000066778]
Predicted Effect probably benign
Transcript: ENSMUST00000051772
SMART Domains Protein: ENSMUSP00000062887
Gene: ENSMUSG00000049670

DomainStartEndE-ValueType
MORN 14 35 1.64e-5 SMART
MORN 37 58 4.15e-2 SMART
MORN 60 81 1.86e-4 SMART
MORN 83 104 1.84e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066778
AA Change: P16L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178
AA Change: P16L

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
Pfam:PI3_PI4_kinase 133 431 1.7e-67 PFAM
Meta Mutation Damage Score 0.0862 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele develop a progressive neurologic disease typified by urinary incontinence, tremor, limb weakness, weight loss, cerebellar gliosis, Purkinje cell loss, degeneration of spinal cord axons and premature death. Mutant males are sterile while females are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Pi4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Pi4k2a APN 19 42104979 missense probably damaging 1.00
IGL02959:Pi4k2a APN 19 42113071 missense probably benign 0.42
R1570:Pi4k2a UTSW 19 42100644 missense probably benign 0.33
R1992:Pi4k2a UTSW 19 42115938 missense probably damaging 1.00
R2113:Pi4k2a UTSW 19 42115071 missense possibly damaging 0.78
R2358:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R2410:Pi4k2a UTSW 19 42104877 missense possibly damaging 0.55
R3708:Pi4k2a UTSW 19 42090931 nonsense probably null
R3712:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R3954:Pi4k2a UTSW 19 42115899 missense probably damaging 0.98
R4654:Pi4k2a UTSW 19 42113105 critical splice donor site probably null
R5077:Pi4k2a UTSW 19 42119836 unclassified probably null
R5386:Pi4k2a UTSW 19 42090515 missense probably damaging 0.99
R5846:Pi4k2a UTSW 19 42115038 missense probably benign 0.01
R5867:Pi4k2a UTSW 19 42105485 critical splice donor site probably null
R5878:Pi4k2a UTSW 19 42100641 missense probably benign 0.02
R6502:Pi4k2a UTSW 19 42090932 missense probably benign 0.04
R7042:Pi4k2a UTSW 19 42104898 missense probably benign 0.18
R7269:Pi4k2a UTSW 19 42090686 missense probably damaging 1.00
R7819:Pi4k2a UTSW 19 42090574 missense probably benign
Z1177:Pi4k2a UTSW 19 42104925 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGCCAAGTAAACAGGACAG -3'
(R):5'- TAGATGCTGCACTCGATGG -3'

Sequencing Primer
(F):5'- CCAAGTAAACAGGACAGGCTAG -3'
(R):5'- TGCACTCGATGGCAACCTC -3'
Posted On2015-02-19