Incidental Mutation 'R3609:Tmem8'
ID269194
Institutional Source Beutler Lab
Gene Symbol Tmem8
Ensembl Gene ENSMUSG00000024180
Gene Nametransmembrane protein 8 (five membrane-spanning domains)
SynonymsM83
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3609 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26113316-26123254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26118886 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 415 (V415I)
Ref Sequence ENSEMBL: ENSMUSP00000025010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
Predicted Effect probably benign
Transcript: ENSMUST00000025010
AA Change: V415I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: V415I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000128597
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,558 T48I possibly damaging Het
Bpifc A T 10: 86,000,638 M1K probably null Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Ces1c A T 8: 93,120,332 I98N probably damaging Het
Clec4b1 T A 6: 123,050,632 L16Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dopey2 A G 16: 93,739,332 Y106C probably damaging Het
Irak3 G T 10: 120,145,677 T441K possibly damaging Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Olfr1042 G A 2: 86,159,632 T246I probably benign Het
Olfr1056 G C 2: 86,355,482 A300G probably damaging Het
Olfr1256 A G 2: 89,835,076 S290P probably damaging Het
Olfr480 A G 7: 108,066,369 F143S probably damaging Het
Rest A C 5: 77,282,800 N1022T probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Vmn2r71 T A 7: 85,619,662 C358S probably damaging Het
Other mutations in Tmem8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Tmem8 APN 17 26117519 missense probably damaging 0.96
IGL01014:Tmem8 APN 17 26117009 unclassified probably benign
IGL02167:Tmem8 APN 17 26119071 missense probably damaging 1.00
IGL02375:Tmem8 APN 17 26119499 missense probably benign 0.05
IGL02892:Tmem8 APN 17 26119120 missense probably damaging 1.00
IGL02931:Tmem8 APN 17 26117949 missense probably benign
IGL03005:Tmem8 APN 17 26118937 missense probably benign 0.01
IGL03124:Tmem8 APN 17 26116834 missense probably damaging 0.98
IGL03046:Tmem8 UTSW 17 26119440 unclassified probably null
R0551:Tmem8 UTSW 17 26120602 missense probably damaging 1.00
R0555:Tmem8 UTSW 17 26117114 missense probably benign 0.19
R1502:Tmem8 UTSW 17 26120316 missense possibly damaging 0.82
R1593:Tmem8 UTSW 17 26118407 missense possibly damaging 0.63
R1688:Tmem8 UTSW 17 26118908 missense possibly damaging 0.94
R1829:Tmem8 UTSW 17 26122220 missense probably damaging 1.00
R2071:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R2117:Tmem8 UTSW 17 26117884 missense possibly damaging 0.67
R3610:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R4564:Tmem8 UTSW 17 26117863 missense possibly damaging 0.80
R4749:Tmem8 UTSW 17 26116783 missense probably damaging 1.00
R4777:Tmem8 UTSW 17 26121541 missense probably damaging 1.00
R4913:Tmem8 UTSW 17 26120539 missense probably damaging 1.00
R5098:Tmem8 UTSW 17 26118928 missense probably damaging 1.00
R5126:Tmem8 UTSW 17 26121640 missense probably damaging 0.99
R5640:Tmem8 UTSW 17 26118872 missense possibly damaging 0.50
R5722:Tmem8 UTSW 17 26120562 frame shift probably null
R5723:Tmem8 UTSW 17 26120562 frame shift probably null
R5739:Tmem8 UTSW 17 26120451 missense probably damaging 1.00
R5927:Tmem8 UTSW 17 26121998 missense probably benign 0.34
R6587:Tmem8 UTSW 17 26121564 missense probably benign 0.03
R6723:Tmem8 UTSW 17 26120636 missense probably damaging 0.96
R7588:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R7621:Tmem8 UTSW 17 26117891 missense probably benign 0.00
R7653:Tmem8 UTSW 17 26120449 missense probably damaging 1.00
R7771:Tmem8 UTSW 17 26122073 missense probably damaging 1.00
R8037:Tmem8 UTSW 17 26117535 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGAACTTTGGGCTAGCAGG -3'
(R):5'- TACCAGTTGTCTGTCTCCGG -3'

Sequencing Primer
(F):5'- CTAGCAGGCGGCCTCCC -3'
(R):5'- CCATGTGAGATGAGGCTCTCAG -3'
Posted On2015-02-19