Incidental Mutation 'R7771:Tmem8'
ID598605
Institutional Source Beutler Lab
Gene Symbol Tmem8
Ensembl Gene ENSMUSG00000024180
Gene Nametransmembrane protein 8 (five membrane-spanning domains)
SynonymsM83
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26113316-26123254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26122073 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 717 (Y717H)
Ref Sequence ENSEMBL: ENSMUSP00000025010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
Predicted Effect probably damaging
Transcript: ENSMUST00000025010
AA Change: Y717H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: Y717H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127647
SMART Domains Protein: ENSMUSP00000115369
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
PDB:4CE4|1 2 44 5e-19 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000128597
AA Change: Y186H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180
AA Change: Y186H

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmprss11b A T 5: 86,661,695 probably null Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Tmem8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Tmem8 APN 17 26117519 missense probably damaging 0.96
IGL01014:Tmem8 APN 17 26117009 unclassified probably benign
IGL02167:Tmem8 APN 17 26119071 missense probably damaging 1.00
IGL02375:Tmem8 APN 17 26119499 missense probably benign 0.05
IGL02892:Tmem8 APN 17 26119120 missense probably damaging 1.00
IGL02931:Tmem8 APN 17 26117949 missense probably benign
IGL03005:Tmem8 APN 17 26118937 missense probably benign 0.01
IGL03124:Tmem8 APN 17 26116834 missense probably damaging 0.98
IGL03046:Tmem8 UTSW 17 26119440 unclassified probably null
R0551:Tmem8 UTSW 17 26120602 missense probably damaging 1.00
R0555:Tmem8 UTSW 17 26117114 missense probably benign 0.19
R1502:Tmem8 UTSW 17 26120316 missense possibly damaging 0.82
R1593:Tmem8 UTSW 17 26118407 missense possibly damaging 0.63
R1688:Tmem8 UTSW 17 26118908 missense possibly damaging 0.94
R1829:Tmem8 UTSW 17 26122220 missense probably damaging 1.00
R2071:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R2117:Tmem8 UTSW 17 26117884 missense possibly damaging 0.67
R3609:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R3610:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R4564:Tmem8 UTSW 17 26117863 missense possibly damaging 0.80
R4749:Tmem8 UTSW 17 26116783 missense probably damaging 1.00
R4777:Tmem8 UTSW 17 26121541 missense probably damaging 1.00
R4913:Tmem8 UTSW 17 26120539 missense probably damaging 1.00
R5098:Tmem8 UTSW 17 26118928 missense probably damaging 1.00
R5126:Tmem8 UTSW 17 26121640 missense probably damaging 0.99
R5640:Tmem8 UTSW 17 26118872 missense possibly damaging 0.50
R5722:Tmem8 UTSW 17 26120562 frame shift probably null
R5723:Tmem8 UTSW 17 26120562 frame shift probably null
R5739:Tmem8 UTSW 17 26120451 missense probably damaging 1.00
R5927:Tmem8 UTSW 17 26121998 missense probably benign 0.34
R6587:Tmem8 UTSW 17 26121564 missense probably benign 0.03
R6723:Tmem8 UTSW 17 26120636 missense probably damaging 0.96
R7588:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R7621:Tmem8 UTSW 17 26117891 missense probably benign 0.00
R7653:Tmem8 UTSW 17 26120449 missense probably damaging 1.00
R8037:Tmem8 UTSW 17 26117535 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCCTGCCCAGATCTAGATAGACC -3'
(R):5'- TTCAGGTGTCCATGAACCAGC -3'

Sequencing Primer
(F):5'- TAGATAGACCCCATACCTCTTGG -3'
(R):5'- AGCCTTATCAGGTCACTGTGTACAAC -3'
Posted On2019-11-26