Incidental Mutation 'R5098:Tmem8'
ID388156
Institutional Source Beutler Lab
Gene Symbol Tmem8
Ensembl Gene ENSMUSG00000024180
Gene Nametransmembrane protein 8 (five membrane-spanning domains)
SynonymsM83
MMRRC Submission 042687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5098 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26113316-26123254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26118928 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 429 (N429Y)
Ref Sequence ENSEMBL: ENSMUSP00000025010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
Predicted Effect probably damaging
Transcript: ENSMUST00000025010
AA Change: N429Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: N429Y

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000128597
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Meta Mutation Damage Score 0.5593 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,798,181 S128P probably damaging Het
Abca8b T C 11: 109,957,118 I784V probably benign Het
Agxt A G 1: 93,137,307 H146R probably benign Het
AI314180 T C 4: 58,877,048 D129G probably damaging Het
Art5 A G 7: 102,097,970 F201L probably damaging Het
Bcl2a1b T A 9: 89,199,379 M7K probably benign Het
Card10 G A 15: 78,776,717 A1030V probably benign Het
Ccdc66 G A 14: 27,498,793 T58M probably damaging Het
Cd72 C T 4: 43,452,610 G74R probably damaging Het
Cdc27 T C 11: 104,507,287 K749R probably damaging Het
Commd3 A T 2: 18,674,177 T102S possibly damaging Het
Cyp2f2 A G 7: 27,129,879 T270A possibly damaging Het
Dclre1b A G 3: 103,809,136 probably benign Het
Dennd1b T A 1: 139,133,721 D380E probably damaging Het
Dhx58 T C 11: 100,695,173 E674G probably benign Het
Exoc5 T C 14: 49,048,847 T108A possibly damaging Het
Fat4 T C 3: 38,888,289 S444P probably benign Het
Gm3327 A T 14: 44,124,835 I64F unknown Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gpr15 T A 16: 58,718,527 R66S probably damaging Het
Hmga1b T C 11: 120,763,192 S102P probably benign Het
Kat6b G A 14: 21,619,015 probably benign Het
Kdm1b A G 13: 47,062,991 Y279C probably damaging Het
Krtap9-3 C A 11: 99,597,990 C22F probably benign Het
Map3k14 T A 11: 103,224,359 D817V probably damaging Het
Mybpc1 T C 10: 88,546,064 D588G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr720 A G 14: 14,175,683 V133A probably benign Het
Olfr998 A G 2: 85,590,632 I31V probably benign Het
Pcdhb20 A G 18: 37,504,805 D128G probably damaging Het
Ppil6 A G 10: 41,490,620 E47G probably null Het
Rad17 A T 13: 100,617,646 *689K probably null Het
Scin A T 12: 40,077,542 Y416* probably null Het
Serf1 A G 13: 100,109,067 T18A probably benign Het
Sik2 T C 9: 50,995,591 probably benign Het
Slc39a8 C A 3: 135,858,157 N254K probably benign Het
Spint3 A G 2: 164,569,901 F63L probably damaging Het
Suox A T 10: 128,671,158 S334T probably damaging Het
Tas2r119 A G 15: 32,178,082 M265V probably benign Het
Tmem126b A G 7: 90,469,642 L146P probably damaging Het
Trpc3 G T 3: 36,662,898 D330E probably benign Het
Ugt2a2 T C 5: 87,464,181 E290G possibly damaging Het
Ugt2b37 T A 5: 87,242,953 T352S probably damaging Het
Vmn1r40 T C 6: 89,714,948 V249A probably damaging Het
Zc3h18 A G 8: 122,386,869 D200G probably damaging Het
Zfp652 T C 11: 95,752,936 V140A probably damaging Het
Other mutations in Tmem8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Tmem8 APN 17 26117519 missense probably damaging 0.96
IGL01014:Tmem8 APN 17 26117009 unclassified probably benign
IGL02167:Tmem8 APN 17 26119071 missense probably damaging 1.00
IGL02375:Tmem8 APN 17 26119499 missense probably benign 0.05
IGL02892:Tmem8 APN 17 26119120 missense probably damaging 1.00
IGL02931:Tmem8 APN 17 26117949 missense probably benign
IGL03005:Tmem8 APN 17 26118937 missense probably benign 0.01
IGL03124:Tmem8 APN 17 26116834 missense probably damaging 0.98
IGL03046:Tmem8 UTSW 17 26119440 unclassified probably null
R0551:Tmem8 UTSW 17 26120602 missense probably damaging 1.00
R0555:Tmem8 UTSW 17 26117114 missense probably benign 0.19
R1502:Tmem8 UTSW 17 26120316 missense possibly damaging 0.82
R1593:Tmem8 UTSW 17 26118407 missense possibly damaging 0.63
R1688:Tmem8 UTSW 17 26118908 missense possibly damaging 0.94
R1829:Tmem8 UTSW 17 26122220 missense probably damaging 1.00
R2071:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R2117:Tmem8 UTSW 17 26117884 missense possibly damaging 0.67
R3609:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R3610:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R4564:Tmem8 UTSW 17 26117863 missense possibly damaging 0.80
R4749:Tmem8 UTSW 17 26116783 missense probably damaging 1.00
R4777:Tmem8 UTSW 17 26121541 missense probably damaging 1.00
R4913:Tmem8 UTSW 17 26120539 missense probably damaging 1.00
R5126:Tmem8 UTSW 17 26121640 missense probably damaging 0.99
R5640:Tmem8 UTSW 17 26118872 missense possibly damaging 0.50
R5722:Tmem8 UTSW 17 26120562 frame shift probably null
R5723:Tmem8 UTSW 17 26120562 frame shift probably null
R5739:Tmem8 UTSW 17 26120451 missense probably damaging 1.00
R5927:Tmem8 UTSW 17 26121998 missense probably benign 0.34
R6587:Tmem8 UTSW 17 26121564 missense probably benign 0.03
R6723:Tmem8 UTSW 17 26120636 missense probably damaging 0.96
R7588:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R7621:Tmem8 UTSW 17 26117891 missense probably benign 0.00
R7653:Tmem8 UTSW 17 26120449 missense probably damaging 1.00
R7771:Tmem8 UTSW 17 26122073 missense probably damaging 1.00
R8037:Tmem8 UTSW 17 26117535 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATGAACTTTGGGCTAGCAGGC -3'
(R):5'- AGTTGTCTGTCTCCGGGAAG -3'

Sequencing Primer
(F):5'- CTAGCAGGCGGCCTCCC -3'
(R):5'- TCTCCGGGAAGGGCATGATG -3'
Posted On2016-06-06