Incidental Mutation 'R3684:Zfp810'
ID 269471
Institutional Source Beutler Lab
Gene Symbol Zfp810
Ensembl Gene ENSMUSG00000066829
Gene Name zinc finger protein 810
Synonyms
MMRRC Submission 040682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R3684 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 22276748-22307648 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22278235 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 459 (D459G)
Ref Sequence ENSEMBL: ENSMUSP00000083459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086278] [ENSMUST00000215202]
AlphaFold Q99K45
Predicted Effect probably benign
Transcript: ENSMUST00000086278
AA Change: D459G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000083459
Gene: ENSMUSG00000066829
AA Change: D459G

DomainStartEndE-ValueType
KRAB 4 64 1.09e-33 SMART
ZnF_C2H2 126 148 2.44e2 SMART
ZnF_C2H2 182 204 3.07e-1 SMART
ZnF_C2H2 210 232 8.47e-4 SMART
ZnF_C2H2 238 260 6.78e-3 SMART
ZnF_C2H2 266 288 6.13e-1 SMART
ZnF_C2H2 294 316 5.06e-2 SMART
ZnF_C2H2 322 344 4.79e-3 SMART
ZnF_C2H2 350 372 2.99e-4 SMART
ZnF_C2H2 378 400 1.33e-1 SMART
ZnF_C2H2 406 428 2.75e-3 SMART
ZnF_C2H2 434 456 1.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214499
Predicted Effect probably benign
Transcript: ENSMUST00000215202
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A T 11: 97,775,699 Y54N probably damaging Het
Adamdec1 C T 14: 68,581,998 V17I probably benign Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atr T C 9: 95,920,400 S1782P probably damaging Het
Btbd9 T A 17: 30,334,307 N394Y probably damaging Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cep83 A G 10: 94,786,825 T588A probably benign Het
Cfap126 T C 1: 171,114,031 S32P possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Dok3 A G 13: 55,524,493 S154P probably damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gls A T 1: 52,166,293 D447E probably damaging Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Jchain G A 5: 88,522,539 P74S probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrrn1 T C 6: 107,567,949 V236A probably benign Het
Mcm3ap T C 10: 76,489,426 S954P possibly damaging Het
Myh11 T C 16: 14,203,234 N1725S probably benign Het
Ppcdc C T 9: 57,421,125 probably null Het
Rhobtb3 A G 13: 75,939,481 I129T probably damaging Het
Sfxn2 A G 19: 46,591,153 R252G probably benign Het
Sh2d2a C A 3: 87,851,720 probably null Het
Sh3gl1 T C 17: 56,018,953 K159E possibly damaging Het
Slc7a9 A G 7: 35,453,501 T115A probably benign Het
Synj2 A T 17: 6,028,443 D1020V probably damaging Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Tmem127 T A 2: 127,248,732 I56N possibly damaging Het
Traj7 A G 14: 54,211,481 probably benign Het
Unc5d A G 8: 28,694,592 F627L probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Usp17la A T 7: 104,861,730 N514I possibly damaging Het
Uvrag A T 7: 98,988,220 C341S probably damaging Het
Other mutations in Zfp810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Zfp810 APN 9 22278309 nonsense probably null
IGL03079:Zfp810 APN 9 22284127 missense probably damaging 1.00
IGL03402:Zfp810 APN 9 22279145 splice site probably null
H8562:Zfp810 UTSW 9 22279091 missense probably benign 0.42
R1116:Zfp810 UTSW 9 22279085 missense probably benign 0.11
R1160:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R1171:Zfp810 UTSW 9 22278826 missense possibly damaging 0.95
R1393:Zfp810 UTSW 9 22280514 missense probably benign
R1608:Zfp810 UTSW 9 22278920 missense probably benign 0.00
R1644:Zfp810 UTSW 9 22279028 missense possibly damaging 0.67
R1766:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R2568:Zfp810 UTSW 9 22279238 missense probably benign 0.01
R4002:Zfp810 UTSW 9 22278892 missense probably damaging 1.00
R4134:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4135:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4334:Zfp810 UTSW 9 22278784 missense probably benign 0.00
R4545:Zfp810 UTSW 9 22278745 missense probably damaging 0.96
R5399:Zfp810 UTSW 9 22278829 missense possibly damaging 0.91
R5622:Zfp810 UTSW 9 22279096 missense probably benign 0.00
R5643:Zfp810 UTSW 9 22283171 missense probably benign 0.26
R7375:Zfp810 UTSW 9 22290537 critical splice donor site probably null
R7441:Zfp810 UTSW 9 22279272 nonsense probably null
R7809:Zfp810 UTSW 9 22278982 missense possibly damaging 0.51
R8422:Zfp810 UTSW 9 22283222 nonsense probably null
R8526:Zfp810 UTSW 9 22278290 missense probably damaging 1.00
R8719:Zfp810 UTSW 9 22279275 missense probably benign 0.00
R9177:Zfp810 UTSW 9 22278640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCCCTAAAGTAATAGATAGGTCT -3'
(R):5'- ACTGCAAGTCTCACCTCACTGT -3'

Sequencing Primer
(F):5'- CTATACATGGAGATGAGCTAGAGACC -3'
(R):5'- TGCAGGAAAGCTTTCTACCG -3'
Posted On 2015-02-19