Incidental Mutation 'R1116:Zfp810'
ID 97289
Institutional Source Beutler Lab
Gene Symbol Zfp810
Ensembl Gene ENSMUSG00000066829
Gene Name zinc finger protein 810
Synonyms
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 22276748-22307648 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22279085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 176 (E176K)
Ref Sequence ENSEMBL: ENSMUSP00000083459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086278] [ENSMUST00000215202]
AlphaFold Q99K45
Predicted Effect probably benign
Transcript: ENSMUST00000086278
AA Change: E176K

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083459
Gene: ENSMUSG00000066829
AA Change: E176K

DomainStartEndE-ValueType
KRAB 4 64 1.09e-33 SMART
ZnF_C2H2 126 148 2.44e2 SMART
ZnF_C2H2 182 204 3.07e-1 SMART
ZnF_C2H2 210 232 8.47e-4 SMART
ZnF_C2H2 238 260 6.78e-3 SMART
ZnF_C2H2 266 288 6.13e-1 SMART
ZnF_C2H2 294 316 5.06e-2 SMART
ZnF_C2H2 322 344 4.79e-3 SMART
ZnF_C2H2 350 372 2.99e-4 SMART
ZnF_C2H2 378 400 1.33e-1 SMART
ZnF_C2H2 406 428 2.75e-3 SMART
ZnF_C2H2 434 456 1.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214499
Predicted Effect probably benign
Transcript: ENSMUST00000215202
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Zfp810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Zfp810 APN 9 22278309 nonsense probably null
IGL03079:Zfp810 APN 9 22284127 missense probably damaging 1.00
IGL03402:Zfp810 APN 9 22279145 splice site probably null
H8562:Zfp810 UTSW 9 22279091 missense probably benign 0.42
R1160:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R1171:Zfp810 UTSW 9 22278826 missense possibly damaging 0.95
R1393:Zfp810 UTSW 9 22280514 missense probably benign
R1608:Zfp810 UTSW 9 22278920 missense probably benign 0.00
R1644:Zfp810 UTSW 9 22279028 missense possibly damaging 0.67
R1766:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R2568:Zfp810 UTSW 9 22279238 missense probably benign 0.01
R3684:Zfp810 UTSW 9 22278235 missense probably benign 0.01
R4002:Zfp810 UTSW 9 22278892 missense probably damaging 1.00
R4134:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4135:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4334:Zfp810 UTSW 9 22278784 missense probably benign 0.00
R4545:Zfp810 UTSW 9 22278745 missense probably damaging 0.96
R5399:Zfp810 UTSW 9 22278829 missense possibly damaging 0.91
R5622:Zfp810 UTSW 9 22279096 missense probably benign 0.00
R5643:Zfp810 UTSW 9 22283171 missense probably benign 0.26
R7375:Zfp810 UTSW 9 22290537 critical splice donor site probably null
R7441:Zfp810 UTSW 9 22279272 nonsense probably null
R7809:Zfp810 UTSW 9 22278982 missense possibly damaging 0.51
R8422:Zfp810 UTSW 9 22283222 nonsense probably null
R8526:Zfp810 UTSW 9 22278290 missense probably damaging 1.00
R8719:Zfp810 UTSW 9 22279275 missense probably benign 0.00
R9177:Zfp810 UTSW 9 22278640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACGGACTTATTAAGTATTACCCTGCTcta -3'
(R):5'- ACCGAGGGGCCAAATCCTATGAA -3'

Sequencing Primer
(F):5'- gcttctcacctgtatgagtcc -3'
(R):5'- GCCAAATCCTATGAATGTGAAGTGTG -3'
Posted On 2014-01-05