Incidental Mutation 'R3767:Pla2g5'
ID273044
Institutional Source Beutler Lab
Gene Symbol Pla2g5
Ensembl Gene ENSMUSG00000041193
Gene Namephospholipase A2, group V
SynonymssPLA2
MMRRC Submission 040744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R3767 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location138799244-138863482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 138801435 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 70 (C70S)
Ref Sequence ENSEMBL: ENSMUSP00000099571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030524] [ENSMUST00000102511] [ENSMUST00000102512] [ENSMUST00000102513]
Predicted Effect probably damaging
Transcript: ENSMUST00000030524
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030524
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102511
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099569
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102512
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099570
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102513
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099571
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154844
Meta Mutation Damage Score 0.9545 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the secretory phospholipase A2 family. It is located in a tightly-linked cluster of secretory phospholipase A2 genes on chromosome 1. The encoded enzyme catalyzes the hydrolysis of membrane phospholipids to generate lysophospholipids and free fatty acids including arachidonic acid. It preferentially hydrolyzes linoleoyl-containing phosphatidylcholine substrates. Secretion of this enzyme is thought to induce inflammatory responses in neighboring cells. Alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced acute zymosan-induced peritonitis and arachadonic acid metabolite release from stimulated peritoneal macrophages. Mice homozygous for a different knock-out allele exhibit reduced response to myocardial ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 23,157,188 V134E possibly damaging Het
Agmat A G 4: 141,755,962 T236A probably benign Het
Anxa9 T C 3: 95,301,114 N197S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Axdnd1 G A 1: 156,380,858 T470M probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cdh3 A T 8: 106,536,974 probably null Het
Cep85l A T 10: 53,291,810 I624K probably benign Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Dchs1 A T 7: 105,757,085 D2313E possibly damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exo1 C T 1: 175,886,746 P73L probably damaging Het
Fgfrl1 C A 5: 108,705,376 H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 G135D probably damaging Het
Herc3 G A 6: 58,862,988 R362H probably benign Het
Herc3 T C 6: 58,876,602 F583L probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Ighv1-54 A G 12: 115,193,976 V17A possibly damaging Het
Kcnh5 A G 12: 75,087,576 Y400H possibly damaging Het
Kcnk16 T A 14: 20,269,162 M1L possibly damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lonp1 T C 17: 56,621,952 E270G possibly damaging Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mrc1 A G 2: 14,319,170 Y1106C probably damaging Het
Mybpc1 G T 10: 88,570,659 probably null Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Nlrp4e G T 7: 23,340,563 L770F probably damaging Het
Npas3 A G 12: 54,069,074 *895W probably null Het
Nphs2 T C 1: 156,313,038 I115T probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr936 T A 9: 39,047,411 H47L unknown Het
Patj A T 4: 98,681,219 K1128* probably null Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ppp1r13b G T 12: 111,846,417 R123S probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Pum2 T A 12: 8,719,076 Y323* probably null Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Selenoi A G 5: 30,256,189 Y141C probably damaging Het
Smcr8 A G 11: 60,779,504 T493A probably benign Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc23l T A 15: 10,530,695 Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdr1 C T 5: 38,540,539 G228R probably damaging Het
Xab2 T C 8: 3,619,053 N31S probably damaging Het
Other mutations in Pla2g5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03304:Pla2g5 APN 4 138804569 nonsense probably null
R0278:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R0323:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R0325:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R3768:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3769:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3770:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R5620:Pla2g5 UTSW 4 138804610 missense possibly damaging 0.83
R6776:Pla2g5 UTSW 4 138800653 missense probably benign 0.00
R7065:Pla2g5 UTSW 4 138800604 missense probably damaging 1.00
R7097:Pla2g5 UTSW 4 138804519 missense probably damaging 1.00
R7122:Pla2g5 UTSW 4 138804519 missense probably damaging 1.00
R7829:Pla2g5 UTSW 4 138804534 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTGAGTCTCAACTGGGACTTCC -3'
(R):5'- CTTTAACATCCAAGCACAGTGTC -3'

Sequencing Primer
(F):5'- CCCTTTCCTGGAAGTCTAAAGAGG -3'
(R):5'- AGTGTCCCCAAGGTACCATTG -3'
Posted On2015-03-25