Incidental Mutation 'R3767:Patj'
ID273041
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
MMRRC Submission 040744-MU
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3767 (G1)
Quality Score196
Status Not validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 98681219 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1128 (K1128*)
Ref Sequence ENSEMBL: ENSMUSP00000102644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030290] [ENSMUST00000041284] [ENSMUST00000102792] [ENSMUST00000107029]
Predicted Effect probably null
Transcript: ENSMUST00000030290
AA Change: K479*
SMART Domains Protein: ENSMUSP00000030290
Gene: ENSMUSG00000061859
AA Change: K479*

DomainStartEndE-ValueType
PDZ 31 106 6.12e-19 SMART
low complexity region 134 144 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
PDZ 258 333 4.36e-24 SMART
PDZ 355 428 2.49e-19 SMART
PDZ 496 573 1.73e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041284
AA Change: K1701*
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: K1701*

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102792
AA Change: K479*
SMART Domains Protein: ENSMUSP00000099854
Gene: ENSMUSG00000061859
AA Change: K479*

DomainStartEndE-ValueType
PDZ 31 106 6.12e-19 SMART
low complexity region 134 144 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
PDZ 258 333 4.36e-24 SMART
PDZ 355 428 2.49e-19 SMART
PDZ 496 573 2.13e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107029
AA Change: K1128*
SMART Domains Protein: ENSMUSP00000102644
Gene: ENSMUSG00000061859
AA Change: K1128*

DomainStartEndE-ValueType
PDZ 1 68 1e-9 SMART
PDZ 123 202 4.7e-18 SMART
low complexity region 407 418 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
PDZ 510 593 4.3e-21 SMART
PDZ 680 755 2.9e-21 SMART
low complexity region 783 793 N/A INTRINSIC
low complexity region 837 855 N/A INTRINSIC
PDZ 907 982 2.2e-26 SMART
PDZ 1004 1077 1.2e-21 SMART
PDZ 1145 1222 1e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 23,157,188 V134E possibly damaging Het
Agmat A G 4: 141,755,962 T236A probably benign Het
Anxa9 T C 3: 95,301,114 N197S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Axdnd1 G A 1: 156,380,858 T470M probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cdh3 A T 8: 106,536,974 probably null Het
Cep85l A T 10: 53,291,810 I624K probably benign Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Dchs1 A T 7: 105,757,085 D2313E possibly damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exo1 C T 1: 175,886,746 P73L probably damaging Het
Fgfrl1 C A 5: 108,705,376 H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 G135D probably damaging Het
Herc3 G A 6: 58,862,988 R362H probably benign Het
Herc3 T C 6: 58,876,602 F583L probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Ighv1-54 A G 12: 115,193,976 V17A possibly damaging Het
Kcnh5 A G 12: 75,087,576 Y400H possibly damaging Het
Kcnk16 T A 14: 20,269,162 M1L possibly damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lonp1 T C 17: 56,621,952 E270G possibly damaging Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mrc1 A G 2: 14,319,170 Y1106C probably damaging Het
Mybpc1 G T 10: 88,570,659 probably null Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Nlrp4e G T 7: 23,340,563 L770F probably damaging Het
Npas3 A G 12: 54,069,074 *895W probably null Het
Nphs2 T C 1: 156,313,038 I115T probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr936 T A 9: 39,047,411 H47L unknown Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ppp1r13b G T 12: 111,846,417 R123S probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Pum2 T A 12: 8,719,076 Y323* probably null Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Selenoi A G 5: 30,256,189 Y141C probably damaging Het
Smcr8 A G 11: 60,779,504 T493A probably benign Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc23l T A 15: 10,530,695 Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdr1 C T 5: 38,540,539 G228R probably damaging Het
Xab2 T C 8: 3,619,053 N31S probably damaging Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
PIT4531001:Patj UTSW 4 98441090 missense probably damaging 0.98
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7066:Patj UTSW 4 98413197 missense probably benign 0.24
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7412:Patj UTSW 4 98411139 missense probably damaging 0.98
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
R7626:Patj UTSW 4 98546987 missense probably benign 0.35
R7658:Patj UTSW 4 98688179 missense probably damaging 1.00
R7664:Patj UTSW 4 98496950 missense possibly damaging 0.92
R7669:Patj UTSW 4 98518942 missense probably damaging 1.00
R7796:Patj UTSW 4 98546983 start codon destroyed probably benign 0.05
R7870:Patj UTSW 4 98424316 missense probably damaging 1.00
R7883:Patj UTSW 4 98611135 missense probably benign 0.00
R7948:Patj UTSW 4 98424310 missense probably damaging 0.99
R8050:Patj UTSW 4 98538964 missense probably benign 0.00
Z1176:Patj UTSW 4 98611130 missense probably benign 0.11
Z1176:Patj UTSW 4 98676318 nonsense probably null
Z1177:Patj UTSW 4 98497174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATGAAGGGTGTGCCTCTAG -3'
(R):5'- GGCCACACTAAGTAGCTTAGGC -3'

Sequencing Primer
(F):5'- TCTAGGACCATGGTAGTGCC -3'
(R):5'- GCTTAGGCTGACTTCAAACTTTC -3'
Posted On2015-03-25