Incidental Mutation 'R3500:Lactb2'
ID273732
Institutional Source Beutler Lab
Gene Symbol Lactb2
Ensembl Gene ENSMUSG00000025937
Gene Namelactamase, beta 2
SynonymsE430032H21Rik, Cgi-83
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R3500 (G1)
Quality Score184
Status Validated
Chromosome1
Chromosomal Location13623330-13660546 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 13660449 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000027071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027071]
Predicted Effect probably null
Transcript: ENSMUST00000027071
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027071
Gene: ENSMUSG00000025937
AA Change: M1K

DomainStartEndE-ValueType
Lactamase_B 30 199 6.69e-30 SMART
Meta Mutation Damage Score 0.9573 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele exhibit at 40 days of age preceeded by decreased body size, lethargy, enlarged and pale liver and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Lactb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lactb2 APN 1 13660374 missense probably damaging 1.00
IGL00595:Lactb2 APN 1 13630126 missense probably benign 0.05
IGL00730:Lactb2 APN 1 13647516 splice site probably benign
R0371:Lactb2 UTSW 1 13650760 missense possibly damaging 0.69
R0782:Lactb2 UTSW 1 13647451 missense probably benign 0.18
R1670:Lactb2 UTSW 1 13660417 missense probably damaging 0.99
R2324:Lactb2 UTSW 1 13638296 missense probably damaging 1.00
R2418:Lactb2 UTSW 1 13660339 missense possibly damaging 0.93
R4345:Lactb2 UTSW 1 13660350 missense probably damaging 1.00
R4664:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4665:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4716:Lactb2 UTSW 1 13638395 missense probably damaging 1.00
R5363:Lactb2 UTSW 1 13630132 missense probably benign 0.22
R5658:Lactb2 UTSW 1 13627418 missense probably benign 0.03
R5734:Lactb2 UTSW 1 13660387 missense probably damaging 1.00
R5918:Lactb2 UTSW 1 13650730 missense probably benign 0.32
R6419:Lactb2 UTSW 1 13638235 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGACTTGGGAAGCCTG -3'
(R):5'- TAAGATAGTGGCCGCCAATC -3'

Sequencing Primer
(F):5'- TGTCCTCCGCAGAGCTC -3'
(R):5'- TGGCCGCCAATCCGCTC -3'
Posted On2015-04-02