Incidental Mutation 'R3500:Rhbdl3'
ID273772
Institutional Source Beutler Lab
Gene Symbol Rhbdl3
Ensembl Gene ENSMUSG00000017692
Gene Namerhomboid like 3
SynonymsVrho, Ventrhoid, Rhbdl4
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80300912-80355955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80319705 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 95 (F95L)
Ref Sequence ENSEMBL: ENSMUSP00000017836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017836]
Predicted Effect probably damaging
Transcript: ENSMUST00000017836
AA Change: F95L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017836
Gene: ENSMUSG00000017692
AA Change: F95L

DomainStartEndE-ValueType
SCOP:d1c7va_ 36 104 2e-12 SMART
Blast:EFh 38 66 6e-11 BLAST
PDB:2RRT|A 43 102 6e-6 PDB
Blast:EFh 74 102 9e-10 BLAST
transmembrane domain 162 184 N/A INTRINSIC
Pfam:Rhomboid 205 362 1.6e-34 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138846
Meta Mutation Damage Score 0.1788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Rhbdl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Rhbdl3 APN 11 80353442 missense probably damaging 1.00
IGL02003:Rhbdl3 APN 11 80337516 missense possibly damaging 0.82
IGL02302:Rhbdl3 APN 11 80353681 makesense probably null
IGL02972:Rhbdl3 APN 11 80331916 splice site probably benign
IGL03028:Rhbdl3 APN 11 80323461 nonsense probably null
IGL03033:Rhbdl3 APN 11 80346827 missense probably damaging 0.99
IGL03113:Rhbdl3 APN 11 80353613 missense possibly damaging 0.69
R0193:Rhbdl3 UTSW 11 80353574 missense possibly damaging 0.55
R0358:Rhbdl3 UTSW 11 80353631 missense probably damaging 0.99
R0481:Rhbdl3 UTSW 11 80323349 splice site probably benign
R0616:Rhbdl3 UTSW 11 80331861 missense probably damaging 0.99
R1171:Rhbdl3 UTSW 11 80353592 missense possibly damaging 0.52
R2166:Rhbdl3 UTSW 11 80319697 missense probably damaging 1.00
R4580:Rhbdl3 UTSW 11 80353645 missense probably damaging 1.00
R4900:Rhbdl3 UTSW 11 80319613 missense probably benign 0.13
R5276:Rhbdl3 UTSW 11 80319666 missense probably benign 0.07
R5513:Rhbdl3 UTSW 11 80331842 missense probably damaging 0.99
R5595:Rhbdl3 UTSW 11 80337583 missense probably damaging 0.99
R5941:Rhbdl3 UTSW 11 80331889 missense probably benign 0.18
R6372:Rhbdl3 UTSW 11 80330656 missense probably damaging 1.00
R6935:Rhbdl3 UTSW 11 80337496 missense probably damaging 1.00
R7252:Rhbdl3 UTSW 11 80337585 missense possibly damaging 0.60
R7389:Rhbdl3 UTSW 11 80346839 missense possibly damaging 0.95
R7404:Rhbdl3 UTSW 11 80346833 missense probably damaging 1.00
R7745:Rhbdl3 UTSW 11 80323579 missense possibly damaging 0.74
R7768:Rhbdl3 UTSW 11 80330621 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTAGAGGGCCAGTTCCAC -3'
(R):5'- TCACCTGTTGAAGCTGAGGC -3'

Sequencing Primer
(F):5'- ATCTCTGTGAGTTCAAGGCCAGC -3'
(R):5'- TGTTGAAGCTGAGGCCATTCAAAC -3'
Posted On2015-04-02