Mutagenetix > Incidental Mutations

Incidental Mutation 'R3500:Plcg2'

273767

Institutional Source

Beutler Lab

Gene Symbol

Plcg2

Ensembl Gene

ENSMUSG00000034330

Gene Name

phospholipase C, gamma 2

Synonyms

Plcg-2, PLCgamma2

MMRRC Submission

040663-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3500 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117498291-117635142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 117612978 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1043 (M1043V)

Ref Sequence

ENSEMBL: ENSMUSP00000079991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081232]

PDB Structure

Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000081232
AA Change: M1043V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: M1043V

Domain	Start	End	E-Value	Type
PH	21	133	1.87e-4	SMART
PLCXc	312	456	2.29e-96	SMART
low complexity region	461	476	N/A	INTRINSIC
PDB:2K2J\|A	478	516	6e-17	PDB
SH2	530	623	2.24e-30	SMART
SH2	644	726	1.16e-28	SMART
SH3	772	828	3.12e-18	SMART
PH	789	910	4.31e0	SMART
PLCYc	930	1044	1.18e-66	SMART
C2	1062	1167	1.41e-15	SMART

Meta Mutation Damage Score

0.3967

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	C	T	4: 107,891,513	R83W	probably damaging	Het
Amhr2	A	G	15: 102,447,066	D188G	probably benign	Het
Arl15	G	A	13: 113,967,692	E102K	probably damaging	Het
Atp10d	C	T	5: 72,245,723	R319C	probably damaging	Het
Cetn4	A	T	3: 37,309,960	F34I	probably benign	Het
Chd8	G	T	14: 52,205,653	H510N	probably benign	Het
Chil5	T	C	3: 106,018,220	D157G	probably damaging	Het
Clcn1	T	C	6: 42,292,995	S251P	probably damaging	Het
Clstn3	A	T	6: 124,431,711	C881S	probably benign	Het
Cnot4	G	A	6: 35,080,141		probably benign	Het
Copg1	G	A	6: 87,895,923		probably benign	Het
Eftud2	A	G	11: 102,844,180	M631T	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Fancb	A	G	X: 164,996,108	T721A	probably damaging	Het
Fat2	A	G	11: 55,260,516	F3800S	probably damaging	Het
Fgd2	T	C	17: 29,365,601	V173A	possibly damaging	Het
Gabrr1	T	C	4: 33,158,184		probably benign	Het
Gata4	C	T	14: 63,200,533	G390S	possibly damaging	Het
Gm9396	C	A	3: 130,068,495		noncoding transcript	Het
Grid2	T	C	6: 63,503,399	S66P	probably damaging	Het
Hdac9	C	A	12: 34,437,353	M16I	probably benign	Het
Kmt2c	A	T	5: 25,299,479	D3610E	probably benign	Het
Lactb2	A	T	1: 13,660,449	M1K	probably null	Het
Ldhb	T	C	6: 142,501,447	D47G	probably damaging	Het
Map3k11	A	T	19: 5,690,247	M1L	probably benign	Het
Mecom	C	T	3: 29,980,912	R205H	probably damaging	Het
Mob1b	A	G	5: 88,749,620	D129G	probably benign	Het
Nbea	A	G	3: 55,681,010	V2436A	possibly damaging	Het
Neb	T	C	2: 52,325,785	N170S	probably damaging	Het
Nedd4l	G	A	18: 65,212,860	A848T	probably damaging	Het
Nr5a1	G	A	2: 38,707,940	R282*	probably null	Het
Olfr1189	A	G	2: 88,591,941	T46A	probably damaging	Het
Olfr1224-ps1	C	T	2: 89,157,059	G39R	probably damaging	Het
Olfr1317	T	C	2: 112,142,127	F61L	possibly damaging	Het
Olfr1426	A	G	19: 12,088,057	V245A	possibly damaging	Het
Olfr589	T	C	7: 103,155,090	Y219C	probably damaging	Het
Pcdhb19	T	A	18: 37,497,479	L109*	probably null	Het
Podxl2	T	C	6: 88,842,918	D554G	probably damaging	Het
Ppp3ca	A	G	3: 136,881,512	T252A	probably benign	Het
Pramel6	A	G	2: 87,509,225	H111R	probably damaging	Het
Prr19	A	G	7: 25,303,267	E130G	probably damaging	Het
Rab44	C	T	17: 29,138,067	A57V	probably benign	Het
Rhbdl3	T	C	11: 80,319,705	F95L	probably damaging	Het
Sdk1	G	T	5: 142,006,616		probably benign	Het
Tas2r122	T	A	6: 132,711,560	K123N	probably damaging	Het
Tbpl2	C	T	2: 24,087,139	R289Q	probably benign	Het
Trpm2	A	G	10: 77,932,302	F788L	probably benign	Het
Ttn	G	T	2: 76,761,165	F19307L	possibly damaging	Het
Ttn	G	A	2: 76,730,284	L29258F	probably damaging	Het
Vmn2r23	T	C	6: 123,713,170	I335T	possibly damaging	Het

Other mutations in Plcg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Plcg2	APN	8	117556071	missense	possibly damaging	0.89
IGL00911:Plcg2	APN	8	117586515	missense	probably benign	0.17
IGL00952:Plcg2	APN	8	117607217	missense	probably benign
IGL01115:Plcg2	APN	8	117557329	missense	probably damaging	1.00
IGL01326:Plcg2	APN	8	117573999	splice site	probably benign
IGL01357:Plcg2	APN	8	117614161	splice site	probably benign
IGL01705:Plcg2	APN	8	117581662	missense	probably damaging	1.00
IGL01755:Plcg2	APN	8	117621241	missense	possibly damaging	0.48
IGL01828:Plcg2	APN	8	117590233	missense	probably damaging	1.00
IGL02307:Plcg2	APN	8	117579896	critical splice donor site	probably null
IGL02345:Plcg2	APN	8	117585180	missense	probably damaging	0.99
IGL02448:Plcg2	APN	8	117607221	missense	probably benign
IGL02587:Plcg2	APN	8	117558113	missense	possibly damaging	0.80
IGL02646:Plcg2	APN	8	117603883	missense	possibly damaging	0.88
IGL03409:Plcg2	APN	8	117583495	missense	probably damaging	0.96
Poseidon	UTSW	8	117615238	missense	probably damaging	1.00
Poseidon2	UTSW	8	117577874	missense	possibly damaging	0.80
queen	UTSW	8	117581707	missense	probably benign	0.00
Seahorse	UTSW	8	117589835	splice site	probably null
Teleost	UTSW	8	117583549	missense	probably damaging	1.00
Theseus	UTSW	8	117596332	missense	probably damaging	0.99
trident	UTSW	8	117612978	missense	probably benign	0.00
R0172:Plcg2	UTSW	8	117579782	missense	probably benign	0.00
R0194:Plcg2	UTSW	8	117573397	splice site	probably benign
R0410:Plcg2	UTSW	8	117615373	missense	probably damaging	0.98
R0462:Plcg2	UTSW	8	117585305	missense	probably benign	0.06
R0494:Plcg2	UTSW	8	117556104	missense	probably damaging	1.00
R0522:Plcg2	UTSW	8	117614288	splice site	probably null
R0612:Plcg2	UTSW	8	117573365	missense	probably benign	0.01
R1239:Plcg2	UTSW	8	117556044	missense	probably benign
R1367:Plcg2	UTSW	8	117615238	missense	probably damaging	1.00
R1608:Plcg2	UTSW	8	117614235	missense	possibly damaging	0.89
R1756:Plcg2	UTSW	8	117592708	missense	probably benign	0.02
R2176:Plcg2	UTSW	8	117612994	missense	probably damaging	1.00
R4043:Plcg2	UTSW	8	117612978	missense	probably benign	0.00
R4654:Plcg2	UTSW	8	117504315	missense	probably benign
R4883:Plcg2	UTSW	8	117607133	nonsense	probably null
R4932:Plcg2	UTSW	8	117607083	missense	probably benign	0.05
R5080:Plcg2	UTSW	8	117590003	missense	probably benign	0.10
R5226:Plcg2	UTSW	8	117577874	missense	possibly damaging	0.80
R5264:Plcg2	UTSW	8	117634793	missense	possibly damaging	0.95
R5298:Plcg2	UTSW	8	117605249	missense	probably benign
R5473:Plcg2	UTSW	8	117634401	missense	probably benign
R5555:Plcg2	UTSW	8	117612995	nonsense	probably null
R5557:Plcg2	UTSW	8	117586557	missense	probably damaging	0.99
R5805:Plcg2	UTSW	8	117598495	critical splice donor site	probably null
R5826:Plcg2	UTSW	8	117610844	missense	probably benign	0.19
R5871:Plcg2	UTSW	8	117504217	missense	probably damaging	1.00
R5894:Plcg2	UTSW	8	117504349	missense	probably damaging	0.99
R6142:Plcg2	UTSW	8	117585271	missense	probably benign
R6609:Plcg2	UTSW	8	117568170	missense	probably benign	0.31
R6684:Plcg2	UTSW	8	117596332	missense	probably damaging	0.99
R6710:Plcg2	UTSW	8	117557347	missense	probably benign	0.05
R6931:Plcg2	UTSW	8	117557319	missense	probably benign	0.24
R6946:Plcg2	UTSW	8	117504190	missense	probably benign
R7036:Plcg2	UTSW	8	117596306	missense	probably benign
R7070:Plcg2	UTSW	8	117596306	missense	probably benign
R7072:Plcg2	UTSW	8	117589835	splice site	probably null
R7214:Plcg2	UTSW	8	117583549	missense	probably damaging	1.00
R7351:Plcg2	UTSW	8	117590310	missense	possibly damaging	0.95
R7393:Plcg2	UTSW	8	117579825	missense	possibly damaging	0.90
R7443:Plcg2	UTSW	8	117504289	missense	probably benign	0.00
R7513:Plcg2	UTSW	8	117579853	missense	probably damaging	0.99
R7609:Plcg2	UTSW	8	117558113	missense	probably benign	0.01
R8134:Plcg2	UTSW	8	117557318	missense	probably damaging	0.98
R8399:Plcg2	UTSW	8	117596362	missense	probably damaging	1.00
RF008:Plcg2	UTSW	8	117573524	splice site	probably null
X0027:Plcg2	UTSW	8	117555983	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGTTTCCCTGGAGTCAGATGTC -3'
(R):5'- ACAGGAAGGGTTTTCAGCCC -3'

Sequencing Primer
(F):5'- CAGATGTCTTTTCTGAACCGC -3'
(R):5'- GGGTTTTCAGCCCAGAATGAC -3'

Posted On

2015-04-02