Incidental Mutation 'R3849:Fcgr2b'
ID275799
Institutional Source Beutler Lab
Gene Symbol Fcgr2b
Ensembl Gene ENSMUSG00000026656
Gene NameFc receptor, IgG, low affinity IIb
SynonymsFc[g]RII, Ly-m20, F630109E10Rik, CD32, LyM-1, FcgRII, Fcgr2, Fcr-2, Fcgr2a, FcgammaRIIB, Fcr-3, Fc gamma RIIB, Ly-17
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170958617-170976547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 170968135 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 75 (N75S)
Ref Sequence ENSEMBL: ENSMUSP00000123774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027966] [ENSMUST00000081103] [ENSMUST00000159688] [ENSMUST00000159969]
Predicted Effect probably benign
Transcript: ENSMUST00000027966
AA Change: N75S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027966
Gene: ENSMUSG00000026656
AA Change: N75S

DomainStartEndE-ValueType
IG 52 125 2.15e-3 SMART
IG 133 211 1.24e-8 SMART
transmembrane domain 224 246 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081103
AA Change: N75S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079882
Gene: ENSMUSG00000026656
AA Change: N75S

DomainStartEndE-ValueType
IG 52 125 2.15e-3 SMART
IG 133 211 1.24e-8 SMART
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159688
AA Change: N75S

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123774
Gene: ENSMUSG00000026656
AA Change: N75S

DomainStartEndE-ValueType
IG 52 125 2.15e-3 SMART
IG 133 211 1.24e-8 SMART
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159969
AA Change: N75S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137669
Gene: ENSMUSG00000026656
AA Change: N75S

DomainStartEndE-ValueType
IG 52 125 2.15e-3 SMART
IG 133 211 1.24e-8 SMART
transmembrane domain 224 246 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161730
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a low affinity receptor for the Fc region of immunoglobulin gamma complexes. The encoded protein is involved in the phagocytosis of immune complexes and in the regulation of antibody production by B-cells. Variations in this gene may increase susceptibilty to systemic lupus erythematosus (SLE). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mutants show increased antibody response, passive cutaneous analphylaxis, autoantibodies and arthritis susceptibility. On C57BL/6, mice die by 9 months with anemia, proteinuria, glomerulonephritis, and inflammatory disease. A strain variant controls expression in germinal center B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Fcgr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fcgr2b APN 1 170961230 missense possibly damaging 0.87
IGL01067:Fcgr2b APN 1 170968053 missense possibly damaging 0.52
IGL02557:Fcgr2b APN 1 170963322 splice site probably null
IGL02886:Fcgr2b APN 1 170965728 missense possibly damaging 0.53
R0828:Fcgr2b UTSW 1 170961030 missense probably damaging 1.00
R1344:Fcgr2b UTSW 1 170961081 missense probably damaging 1.00
R1418:Fcgr2b UTSW 1 170961081 missense probably damaging 1.00
R4163:Fcgr2b UTSW 1 170963447 missense possibly damaging 0.71
R4969:Fcgr2b UTSW 1 170963372 missense probably benign 0.29
R5308:Fcgr2b UTSW 1 170965710 missense probably benign 0.02
R5778:Fcgr2b UTSW 1 170963388 missense probably damaging 0.97
R6974:Fcgr2b UTSW 1 170963408 critical splice donor site probably null
R7201:Fcgr2b UTSW 1 170963397 missense probably benign
R7247:Fcgr2b UTSW 1 170965700 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGATGCTTCCCAGAAACCAG -3'
(R):5'- TAGCAGAAACTTGGGGCCTG -3'

Sequencing Primer
(F):5'- GTATCCCATCTCCTCCCAGGG -3'
(R):5'- AAACTTGGGGCCTGCTGAG -3'
Posted On2015-04-06