Incidental Mutation 'R3849:Car8'
ID275802
Institutional Source Beutler Lab
Gene Symbol Car8
Ensembl Gene ENSMUSG00000041261
Gene Namecarbonic anhydrase 8
SynonymsCA-RP VIII, Carp, Cals1, wdl
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location8143362-8239041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8189353 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 154 (I154F)
Ref Sequence ENSEMBL: ENSMUSP00000063511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066674]
Predicted Effect probably benign
Transcript: ENSMUST00000066674
AA Change: I154F

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000063511
Gene: ENSMUSG00000041261
AA Change: I154F

DomainStartEndE-ValueType
Carb_anhydrase 30 290 1.32e-110 SMART
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was initially named CA-related protein because of sequence similarity to other known carbonic anhydrase genes. However, the gene product lacks carbonic anhydrase activity (i.e., the reversible hydration of carbon dioxide). The gene product continues to carry a carbonic anhydrase designation based on clear sequence identity to other members of the carbonic anhydrase gene family. The absence of CA8 gene transcription in the cerebellum of the lurcher mutant in mice with a neurologic defect suggests an important role for this acatalytic form. Mutations in this gene are associated with cerebellar ataxia, mental retardation, and dysequilibrium syndrome 3 (CMARQ3). Polymorphisms in this gene are associated with osteoporosis, and overexpression of this gene in osteosarcoma cells suggests an oncogenic role. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a spontaneous deletion exhibit a wobbly side-to-side gait which is first noted at two weeks of age and persists throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Car8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Car8 APN 4 8183251 critical splice donor site probably null
IGL01506:Car8 APN 4 8169761 missense probably damaging 0.98
IGL01679:Car8 APN 4 8169674 missense possibly damaging 0.73
IGL02364:Car8 APN 4 8183321 missense probably benign
IGL02698:Car8 APN 4 8185598 missense probably benign 0.01
R0723:Car8 UTSW 4 8169703 missense probably benign 0.03
R0893:Car8 UTSW 4 8238119 splice site probably null
R1451:Car8 UTSW 4 8189327 missense probably benign 0.09
R1676:Car8 UTSW 4 8185616 missense probably damaging 1.00
R1796:Car8 UTSW 4 8221671 nonsense probably null
R3915:Car8 UTSW 4 8184576 splice site probably benign
R4078:Car8 UTSW 4 8169731 missense possibly damaging 0.49
R4717:Car8 UTSW 4 8169685 missense probably damaging 1.00
R6484:Car8 UTSW 4 8189362 missense probably benign 0.11
R6981:Car8 UTSW 4 8185650 splice site probably null
R7745:Car8 UTSW 4 8237939 missense possibly damaging 0.67
R7832:Car8 UTSW 4 8238860 missense possibly damaging 0.95
R7915:Car8 UTSW 4 8238860 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAACTCTTGAGAACTGACTGTC -3'
(R):5'- AAGCGCTCTTTGAGACAGCTTC -3'

Sequencing Primer
(F):5'- GAGAACTGACTGTCAAATTATGAGC -3'
(R):5'- AGACAGCTTCTCCTGGGG -3'
Posted On2015-04-06