Incidental Mutation 'R3849:Hoxc10'
ID275838
Institutional Source Beutler Lab
Gene Symbol Hoxc10
Ensembl Gene ENSMUSG00000022484
Gene Namehomeobox C10
SynonymsHox-3.6
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102966796-102971893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102967444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000001699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001699]
Predicted Effect probably benign
Transcript: ENSMUST00000001699
AA Change: V196A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001699
Gene: ENSMUSG00000022484
AA Change: V196A

DomainStartEndE-ValueType
low complexity region 143 157 N/A INTRINSIC
HOX 268 330 2.68e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The protein level is controlled during cell differentiation and proliferation, which may indicate this protein has a role in origin activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit skeletal transformations in thoracic, lumbar and sacral vertebrae, alterations in the pelvis and in the bones and ligaments of the hindlimb, femoral defects, decreased lumbar motor neuron and rib number, impairedcoordination, muscle wasting, and obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Hoxc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:Hoxc10 UTSW 15 102967482 missense probably benign 0.07
R1529:Hoxc10 UTSW 15 102967200 missense probably damaging 1.00
R1771:Hoxc10 UTSW 15 102967087 missense probably damaging 1.00
R2139:Hoxc10 UTSW 15 102967477 missense probably benign 0.19
R2962:Hoxc10 UTSW 15 102967300 missense probably damaging 1.00
R3850:Hoxc10 UTSW 15 102967444 missense probably benign 0.00
R4507:Hoxc10 UTSW 15 102966952 missense probably damaging 1.00
R4650:Hoxc10 UTSW 15 102967263 missense probably benign 0.02
R5640:Hoxc10 UTSW 15 102967267 missense probably benign 0.39
R5951:Hoxc10 UTSW 15 102967318 missense possibly damaging 0.52
R6240:Hoxc10 UTSW 15 102970830 missense probably damaging 1.00
R6899:Hoxc10 UTSW 15 102967507 missense possibly damaging 0.83
R7110:Hoxc10 UTSW 15 102970921 missense probably damaging 1.00
R8012:Hoxc10 UTSW 15 102967467 missense not run
Predicted Primers PCR Primer
(F):5'- CTGCATGTACAGTGCAGAGAAG -3'
(R):5'- GACGGCCTTACCTTTAGCTTCG -3'

Sequencing Primer
(F):5'- AGTCTTGCCTTGGGGAGCAC -3'
(R):5'- CGTTATCCGAGGTGTCTGGAC -3'
Posted On2015-04-06