Incidental Mutation 'R3871:Tnpo2'
ID 276563
Institutional Source Beutler Lab
Gene Symbol Tnpo2
Ensembl Gene ENSMUSG00000031691
Gene Name transportin 2 (importin 3, karyopherin beta 2b)
Synonyms Kpnb2b, 1110034O24Rik, TRN2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3871 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 85763544-85784212 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85781380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 789 (C789S)
Ref Sequence ENSEMBL: ENSMUSP00000133076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000166592] [ENSMUST00000166592] [ENSMUST00000211601] [ENSMUST00000211601]
AlphaFold Q99LG2
Predicted Effect probably null
Transcript: ENSMUST00000093360
AA Change: C789S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691
AA Change: C789S

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156084
Predicted Effect probably null
Transcript: ENSMUST00000166592
AA Change: C789S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691
AA Change: C789S

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166592
AA Change: C789S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691
AA Change: C789S

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210461
Predicted Effect probably null
Transcript: ENSMUST00000211601
AA Change: C779S

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably null
Transcript: ENSMUST00000211601
AA Change: C779S

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210576
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,602,117 (GRCm39) Y225* probably null Het
Bard1 T C 1: 71,114,099 (GRCm39) K294R probably benign Het
Bcap29 A T 12: 31,667,080 (GRCm39) S194T probably benign Het
Ccdc40 G A 11: 119,155,107 (GRCm39) V1116M probably damaging Het
Cntnap5a A G 1: 115,987,979 (GRCm39) E170G probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Cyp2c54 T C 19: 40,060,867 (GRCm39) D92G probably benign Het
Dpp6 T C 5: 27,674,463 (GRCm39) F197L probably benign Het
Filip1l G T 16: 57,333,649 (GRCm39) K147N probably damaging Het
Hrnr T A 3: 93,239,181 (GRCm39) S3140T unknown Het
Igfn1 G T 1: 135,896,574 (GRCm39) H1331N probably benign Het
Kalrn C T 16: 34,024,226 (GRCm39) probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,748,902 (GRCm39) probably benign Het
Mfng A G 15: 78,640,821 (GRCm39) L308P probably damaging Het
Nt5e C A 9: 88,246,746 (GRCm39) N327K probably benign Het
Or5m13 T G 2: 85,748,926 (GRCm39) probably null Het
Pgbd1 C T 13: 21,618,540 (GRCm39) R39H possibly damaging Het
Phactr4 T C 4: 132,104,560 (GRCm39) T256A probably benign Het
Rab24 T C 13: 55,468,992 (GRCm39) D63G probably damaging Het
Rubcnl C T 14: 75,278,356 (GRCm39) P380L probably benign Het
Satb2 A G 1: 56,930,379 (GRCm39) S215P probably damaging Het
Serpina3b A T 12: 104,105,047 (GRCm39) I408F probably damaging Het
Setx A G 2: 29,035,753 (GRCm39) D746G probably damaging Het
Sf3a2 A C 10: 80,640,527 (GRCm39) probably benign Het
Snx33 T C 9: 56,834,024 (GRCm39) N15S probably benign Het
Snx9 C T 17: 5,942,056 (GRCm39) P61L probably benign Het
Sult2a6 T C 7: 13,988,701 (GRCm39) K20E probably benign Het
Tas2r122 A G 6: 132,688,543 (GRCm39) S117P probably benign Het
Tmem26 G A 10: 68,614,562 (GRCm39) E326K probably benign Het
Togaram1 A C 12: 65,049,419 (GRCm39) E1285D probably benign Het
Ubxn7 T A 16: 32,200,248 (GRCm39) S335T possibly damaging Het
Unc119b G A 5: 115,268,567 (GRCm39) T106M probably damaging Het
Usp14 A G 18: 10,002,370 (GRCm39) S314P possibly damaging Het
Usp32 T C 11: 84,971,982 (GRCm39) D129G probably null Het
Other mutations in Tnpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tnpo2 APN 8 85,767,155 (GRCm39) missense probably damaging 0.98
IGL01843:Tnpo2 APN 8 85,777,137 (GRCm39) missense probably damaging 0.99
IGL02475:Tnpo2 APN 8 85,777,131 (GRCm39) missense probably benign 0.33
IGL02536:Tnpo2 APN 8 85,771,696 (GRCm39) missense probably benign
IGL02644:Tnpo2 APN 8 85,771,109 (GRCm39) missense possibly damaging 0.62
IGL02721:Tnpo2 APN 8 85,781,319 (GRCm39) critical splice acceptor site probably null
IGL03155:Tnpo2 APN 8 85,771,709 (GRCm39) missense probably benign 0.03
IGL03198:Tnpo2 APN 8 85,778,347 (GRCm39) missense possibly damaging 0.75
boisterous UTSW 8 85,776,786 (GRCm39) missense probably damaging 1.00
Raucous UTSW 8 85,767,257 (GRCm39) missense probably damaging 1.00
R0127:Tnpo2 UTSW 8 85,767,257 (GRCm39) missense probably damaging 1.00
R0456:Tnpo2 UTSW 8 85,781,045 (GRCm39) missense probably damaging 1.00
R0505:Tnpo2 UTSW 8 85,773,991 (GRCm39) missense probably benign 0.01
R0513:Tnpo2 UTSW 8 85,780,158 (GRCm39) missense probably benign 0.00
R0531:Tnpo2 UTSW 8 85,776,786 (GRCm39) missense probably damaging 1.00
R0595:Tnpo2 UTSW 8 85,778,670 (GRCm39) nonsense probably null
R1113:Tnpo2 UTSW 8 85,781,982 (GRCm39) missense probably damaging 1.00
R1308:Tnpo2 UTSW 8 85,781,982 (GRCm39) missense probably damaging 1.00
R1851:Tnpo2 UTSW 8 85,778,401 (GRCm39) missense probably damaging 1.00
R1965:Tnpo2 UTSW 8 85,771,946 (GRCm39) critical splice donor site probably null
R2057:Tnpo2 UTSW 8 85,776,742 (GRCm39) missense probably damaging 1.00
R2184:Tnpo2 UTSW 8 85,780,475 (GRCm39) missense probably benign 0.35
R3801:Tnpo2 UTSW 8 85,781,800 (GRCm39) splice site probably null
R4095:Tnpo2 UTSW 8 85,765,048 (GRCm39) missense probably damaging 1.00
R4611:Tnpo2 UTSW 8 85,780,432 (GRCm39) missense probably benign 0.38
R4925:Tnpo2 UTSW 8 85,776,654 (GRCm39) missense probably damaging 1.00
R5744:Tnpo2 UTSW 8 85,778,523 (GRCm39) nonsense probably null
R6107:Tnpo2 UTSW 8 85,780,104 (GRCm39) missense probably damaging 1.00
R6581:Tnpo2 UTSW 8 85,782,033 (GRCm39) missense probably damaging 1.00
R6586:Tnpo2 UTSW 8 85,771,831 (GRCm39) missense possibly damaging 0.83
R7173:Tnpo2 UTSW 8 85,781,707 (GRCm39) missense probably benign 0.05
R7196:Tnpo2 UTSW 8 85,773,766 (GRCm39) missense possibly damaging 0.91
R7382:Tnpo2 UTSW 8 85,776,748 (GRCm39) missense probably damaging 0.98
R7383:Tnpo2 UTSW 8 85,776,748 (GRCm39) missense probably damaging 0.98
R7384:Tnpo2 UTSW 8 85,776,748 (GRCm39) missense probably damaging 0.98
R7385:Tnpo2 UTSW 8 85,776,748 (GRCm39) missense probably damaging 0.98
R7453:Tnpo2 UTSW 8 85,781,651 (GRCm39) missense probably damaging 1.00
R7488:Tnpo2 UTSW 8 85,781,663 (GRCm39) missense probably benign 0.03
R7638:Tnpo2 UTSW 8 85,771,044 (GRCm39) missense probably benign 0.01
R8004:Tnpo2 UTSW 8 85,771,328 (GRCm39) missense probably benign 0.26
R8021:Tnpo2 UTSW 8 85,781,835 (GRCm39) missense probably damaging 1.00
R8042:Tnpo2 UTSW 8 85,778,188 (GRCm39) missense probably damaging 1.00
R8403:Tnpo2 UTSW 8 85,773,926 (GRCm39) missense probably benign 0.02
R8794:Tnpo2 UTSW 8 85,765,114 (GRCm39) missense probably benign 0.14
R9031:Tnpo2 UTSW 8 85,780,163 (GRCm39) missense probably benign 0.17
R9218:Tnpo2 UTSW 8 85,776,609 (GRCm39) missense possibly damaging 0.75
R9456:Tnpo2 UTSW 8 85,774,015 (GRCm39) missense probably benign 0.01
R9747:Tnpo2 UTSW 8 85,781,988 (GRCm39) missense probably benign
X0027:Tnpo2 UTSW 8 85,771,524 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTATGGGCCAAACTCAAGG -3'
(R):5'- CAGGTCAGTGGATGGACTTG -3'

Sequencing Primer
(F):5'- ACTCAAGGGCCCAGGATAGC -3'
(R):5'- TGGAGGGTACAGCTGTC -3'
Posted On 2015-04-06