Mutagenetix > Incidental Mutation

Incidental Mutation 'R3871:Snx9'

276583

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

Accession Numbers

Essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R3871 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5891781 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 61 (P61L)

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

AlphaFold

Q91VH2

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000002436
AA Change: P61L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: P61L

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231803

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1a1	T	A	19: 20,624,753	Y225*	probably null	Het
Bard1	T	C	1: 71,074,940	K294R	probably benign	Het
Bcap29	A	T	12: 31,617,081	S194T	probably benign	Het
Ccdc40	G	A	11: 119,264,281	V1116M	probably damaging	Het
Cntnap5a	A	G	1: 116,060,249	E170G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp2c54	T	C	19: 40,072,423	D92G	probably benign	Het
Dpp6	T	C	5: 27,469,465	F197L	probably benign	Het
Filip1l	G	T	16: 57,513,286	K147N	probably damaging	Het
Hrnr	T	A	3: 93,331,874	S3140T	unknown	Het
Igfn1	G	T	1: 135,968,836	H1331N	probably benign	Het
Kalrn	C	T	16: 34,203,856		probably null	Het
Kmt2d	TTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGC	15: 98,851,021		probably benign	Het
Mfng	A	G	15: 78,756,621	L308P	probably damaging	Het
Nt5e	C	A	9: 88,364,693	N327K	probably benign	Het
Olfr1025-ps1	T	G	2: 85,918,582		probably null	Het
Pgbd1	C	T	13: 21,434,370	R39H	possibly damaging	Het
Phactr4	T	C	4: 132,377,249	T256A	probably benign	Het
Rab24	T	C	13: 55,321,179	D63G	probably damaging	Het
Rubcnl	C	T	14: 75,040,916	P380L	probably benign	Het
Satb2	A	G	1: 56,891,220	S215P	probably damaging	Het
Serpina3b	A	T	12: 104,138,788	I408F	probably damaging	Het
Setx	A	G	2: 29,145,741	D746G	probably damaging	Het
Sf3a2	A	C	10: 80,804,693		probably benign	Het
Snx33	T	C	9: 56,926,740	N15S	probably benign	Het
Sult2a6	T	C	7: 14,254,776	K20E	probably benign	Het
Tas2r122	A	G	6: 132,711,580	S117P	probably benign	Het
Tmem26	G	A	10: 68,778,732	E326K	probably benign	Het
Tnpo2	T	A	8: 85,054,751	C789S	probably null	Het
Togaram1	A	C	12: 65,002,645	E1285D	probably benign	Het
Ubxn7	T	A	16: 32,381,430	S335T	possibly damaging	Het
Unc119b	G	A	5: 115,130,508	T106M	probably damaging	Het
Usp14	A	G	18: 10,002,370	S314P	possibly damaging	Het
Usp32	T	C	11: 85,081,156	D129G	probably null	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
PIT4495001:Snx9	UTSW	17	5920126	missense	possibly damaging	0.54
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1065:Snx9	UTSW	17	5902361	splice site	probably benign
R1421:Snx9	UTSW	17	5902484	missense	probably benign	0.45
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1823:Snx9	UTSW	17	5920671	missense	probably damaging	1.00
R1914:Snx9	UTSW	17	5928256	missense	possibly damaging	0.65
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5137:Snx9	UTSW	17	5928253	missense	probably damaging	1.00
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5624:Snx9	UTSW	17	5891809	nonsense	probably null
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6263:Snx9	UTSW	17	5887049	missense	probably damaging	0.98
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00
R7873:Snx9	UTSW	17	5918476	missense	possibly damaging	0.81
R8471:Snx9	UTSW	17	5890090	missense	probably damaging	1.00
R9451:Snx9	UTSW	17	5899493	missense	probably damaging	0.99
R9748:Snx9	UTSW	17	5899395	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGATTAACCAGTCACAGAGTGC -3'
(R):5'- AGCCTAGCTCTCAGGAAAGC -3'

Sequencing Primer
(F):5'- CAGTCACAGAGTGCTTCTCAGAG -3'
(R):5'- TAGCTCTCAGGAAAGCCAGCC -3'

Posted On

2015-04-06