Incidental Mutation 'R4713:Vipr2'
ID500019
Institutional Source Beutler Lab
Gene Symbol Vipr2
Ensembl Gene ENSMUSG00000011171
Gene Namevasoactive intestinal peptide receptor 2
SynonymsVPAC2R, VPAC2, VIP receptor subtype 2, Vip2
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116077726-116146261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 116080131 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 49 (R49S)
Ref Sequence ENSEMBL: ENSMUSP00000011315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011315]
Predicted Effect probably benign
Transcript: ENSMUST00000011315
AA Change: R49S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000011315
Gene: ENSMUSG00000011171
AA Change: R49S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 47 117 8.35e-25 SMART
Pfam:7tm_2 122 370 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177199
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced delayed-type hypersensitivity (type IV) and reduced immediate-type hypersensitivity (type I). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Vipr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Vipr2 APN 12 116138748 splice site probably null
IGL02233:Vipr2 APN 12 116094736 missense probably damaging 0.99
IGL02691:Vipr2 APN 12 116136229 missense probably benign 0.11
PIT4377001:Vipr2 UTSW 12 116094798 missense probably benign 0.01
R0135:Vipr2 UTSW 12 116142827 missense probably benign 0.00
R0207:Vipr2 UTSW 12 116142882 missense probably damaging 1.00
R1389:Vipr2 UTSW 12 116137330 missense probably benign 0.01
R1560:Vipr2 UTSW 12 116094781 missense probably benign 0.18
R1575:Vipr2 UTSW 12 116144272 missense probably benign
R1696:Vipr2 UTSW 12 116139157 missense probably benign 0.13
R1970:Vipr2 UTSW 12 116136206 missense probably benign 0.01
R2010:Vipr2 UTSW 12 116122810 critical splice donor site probably null
R3873:Vipr2 UTSW 12 116136104 unclassified probably benign
R4953:Vipr2 UTSW 12 116144256 missense probably benign 0.07
R6041:Vipr2 UTSW 12 116142984 missense probably damaging 1.00
R6337:Vipr2 UTSW 12 116122743 nonsense probably null
R6902:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R6946:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R7763:Vipr2 UTSW 12 116122718 missense probably damaging 1.00
X0066:Vipr2 UTSW 12 116142945 splice site probably null
X0067:Vipr2 UTSW 12 116139172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCGTTGGATCTTCCTGTAG -3'
(R):5'- AGCCATGGAAACTGTTGGTG -3'

Sequencing Primer
(F):5'- AGATTTTTGCTTAACCCTCTCTTGTG -3'
(R):5'- CCATGGAAACTGTTGGTGTAAAGC -3'
Posted On2017-11-30