Incidental Mutation 'R3842:Tasp1'
ID277192
Institutional Source Beutler Lab
Gene Symbol Tasp1
Ensembl Gene ENSMUSG00000039033
Gene Nametaspase, threonine aspartase 1
Synonyms
MMRRC Submission 040782-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R3842 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location139833480-140066805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139951501 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 252 (S252C)
Ref Sequence ENSEMBL: ENSMUSP00000105706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046656] [ENSMUST00000099304] [ENSMUST00000110079]
Predicted Effect probably damaging
Transcript: ENSMUST00000046656
AA Change: S252C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039546
Gene: ENSMUSG00000039033
AA Change: S252C

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 346 1.1e-50 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099304
AA Change: S252C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096907
Gene: ENSMUSG00000039033
AA Change: S252C

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 286 1.1e-46 PFAM
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110079
AA Change: S252C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105706
Gene: ENSMUSG00000039033
AA Change: S252C

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 348 1.3e-62 PFAM
Meta Mutation Damage Score 0.9350 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display prenatal and early postnatal lethality, reduced body size, impaired suckling behavior, homeotic transformations of the axial skeleton, and cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,251,543 R318H probably damaging Het
Adamts16 T C 13: 70,738,891 Y958C possibly damaging Het
Apol7e A G 15: 77,717,589 E129G probably damaging Het
Bmp2k A G 5: 97,087,151 probably benign Het
Camk2g T C 14: 20,764,898 H26R probably damaging Het
Cpn2 A G 16: 30,260,518 S122P probably damaging Het
Dhcr24 G T 4: 106,585,805 G346C probably damaging Het
Egf G A 3: 129,697,793 R351* probably null Het
Exosc10 T A 4: 148,563,865 Y260* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Fbxo30 A G 10: 11,290,112 S193G probably damaging Het
Grik3 T C 4: 125,693,954 probably benign Het
Gtf3c6 A T 10: 40,254,321 probably null Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hmgb2 T A 8: 57,513,354 S121T probably benign Het
Hyal2 T C 9: 107,572,121 S359P probably damaging Het
Itgbl1 A G 14: 123,840,565 T156A possibly damaging Het
Lrrk2 C A 15: 91,755,916 Q1555K probably benign Het
Myom1 T C 17: 71,045,624 V349A probably damaging Het
Naa40 A T 19: 7,229,809 probably benign Het
Ncam2 A G 16: 81,434,810 Y54C probably damaging Het
Nemf C T 12: 69,331,949 S533N probably damaging Het
Nkain1 T A 4: 130,537,296 I80F probably damaging Het
Olfr1335 A G 4: 118,809,255 V203A probably damaging Het
Olfr695 G A 7: 106,874,095 T50I probably benign Het
Olfr825 G A 10: 130,162,901 R142C probably benign Het
Pde3b T C 7: 114,526,867 S779P probably damaging Het
Prkar2a A G 9: 108,728,268 Y175C probably damaging Het
Slc44a5 T C 3: 154,261,394 probably benign Het
Smgc T A 15: 91,860,262 probably benign Het
Tgfbrap1 A T 1: 43,059,154 Y489N probably damaging Het
Topors C T 4: 40,262,123 R387H probably benign Het
Ttn A G 2: 76,789,619 S15902P probably damaging Het
Ttn T C 2: 76,850,303 probably null Het
Other mutations in Tasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Tasp1 APN 2 139977618 missense probably damaging 1.00
IGL01476:Tasp1 APN 2 140008773 missense probably benign 0.01
IGL02876:Tasp1 APN 2 139834363 missense probably benign 0.45
PIT4449001:Tasp1 UTSW 2 139910535 missense possibly damaging 0.67
R0352:Tasp1 UTSW 2 139951458 critical splice donor site probably null
R0381:Tasp1 UTSW 2 139951483 missense probably damaging 1.00
R1056:Tasp1 UTSW 2 140008764 missense possibly damaging 0.94
R1350:Tasp1 UTSW 2 140057421 missense probably damaging 1.00
R1836:Tasp1 UTSW 2 139951557 missense probably damaging 1.00
R2005:Tasp1 UTSW 2 139977678 missense probably damaging 1.00
R2129:Tasp1 UTSW 2 140048244 missense possibly damaging 0.75
R2259:Tasp1 UTSW 2 139951506 missense probably damaging 1.00
R2321:Tasp1 UTSW 2 140057412 missense probably benign 0.05
R3700:Tasp1 UTSW 2 139910554 missense probably benign 0.00
R5526:Tasp1 UTSW 2 140008789 missense probably damaging 1.00
R5724:Tasp1 UTSW 2 140057419 missense probably damaging 0.99
R6345:Tasp1 UTSW 2 139951537 missense probably damaging 1.00
R6533:Tasp1 UTSW 2 139834357 makesense probably null
R7723:Tasp1 UTSW 2 139985131 missense probably damaging 1.00
R7796:Tasp1 UTSW 2 140008785 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGAGCCCTGTCACCAAGAG -3'
(R):5'- CAGGCCTACTAAGTACTGTGC -3'

Sequencing Primer
(F):5'- CACCAAGAGATGGTGCTTTA -3'
(R):5'- GGCCTACTAAGTACTGTGCACTATG -3'
Posted On2015-04-06