Incidental Mutation 'R3896:Map4k2'
ID310566
Institutional Source Beutler Lab
Gene Symbol Map4k2
Ensembl Gene ENSMUSG00000024948
Gene Namemitogen-activated protein kinase kinase kinase kinase 2
SynonymsRab8ip, BL44
MMRRC Submission 040807-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R3896 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6341135-6355615 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 6341928 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 91 (E91*)
Ref Sequence ENSEMBL: ENSMUSP00000120123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000056391] [ENSMUST00000078137] [ENSMUST00000079327] [ENSMUST00000113500] [ENSMUST00000113501] [ENSMUST00000113502] [ENSMUST00000113503] [ENSMUST00000113504] [ENSMUST00000124556] [ENSMUST00000130382] [ENSMUST00000142496] [ENSMUST00000152349] [ENSMUST00000166909] [ENSMUST00000170132]
Predicted Effect probably null
Transcript: ENSMUST00000025897
AA Change: E91*
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948
AA Change: E91*

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056391
SMART Domains Protein: ENSMUSP00000058149
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078137
SMART Domains Protein: ENSMUSP00000077272
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 396 2.6e-241 PFAM
Pfam:Menin 392 556 1.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079327
SMART Domains Protein: ENSMUSP00000078306
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113500
SMART Domains Protein: ENSMUSP00000109128
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113501
SMART Domains Protein: ENSMUSP00000109129
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 183 2.6e-104 PFAM
Pfam:Menin 184 576 3.2e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113502
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113503
SMART Domains Protein: ENSMUSP00000109131
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 616 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113504
SMART Domains Protein: ENSMUSP00000109132
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124333
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127809
Predicted Effect probably benign
Transcript: ENSMUST00000128170
SMART Domains Protein: ENSMUSP00000121856
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:CNH 2 142 3.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130382
AA Change: E91*
SMART Domains Protein: ENSMUSP00000120123
Gene: ENSMUSG00000024948
AA Change: E91*

DomainStartEndE-ValueType
S_TKc 16 233 3.4e-14 SMART
low complexity region 314 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137095
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152259
Predicted Effect probably benign
Transcript: ENSMUST00000152349
SMART Domains Protein: ENSMUSP00000115741
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 57 3.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156154
Predicted Effect probably benign
Transcript: ENSMUST00000166909
SMART Domains Protein: ENSMUSP00000133085
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 62 8.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170132
SMART Domains Protein: ENSMUSP00000126655
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 135 1.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170292
SMART Domains Protein: ENSMUSP00000128607
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 4 106 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184812
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,651,113 N13K possibly damaging Het
4931428F04Rik T A 8: 105,283,288 H343L probably benign Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap20 A T 9: 51,816,837 I117F probably damaging Het
Asz1 A G 6: 18,075,767 I269T probably benign Het
Atp8a2 C A 14: 60,026,140 probably null Het
Atp8b2 A T 3: 89,957,319 I163K probably damaging Het
Casd1 T A 6: 4,640,980 F700L probably damaging Het
Ccdc80 A G 16: 45,096,621 D580G probably benign Het
Cog7 C T 7: 121,941,169 probably benign Het
Cyp2c66 T C 19: 39,142,278 V112A possibly damaging Het
D130040H23Rik T A 8: 69,302,958 C356S probably damaging Het
Emb A G 13: 117,273,062 *331W probably null Het
Enpp3 A C 10: 24,777,949 S703R possibly damaging Het
Fam13b T C 18: 34,462,955 probably benign Het
Foxp1 T A 6: 99,075,936 Q97L probably benign Het
Gdf10 A T 14: 33,934,481 N467Y probably damaging Het
Gm29394 C T 15: 58,048,628 probably benign Het
Gsn T C 2: 35,302,638 S522P possibly damaging Het
Hydin T A 8: 110,509,079 F1899I possibly damaging Het
Ints1 C A 5: 139,757,644 E1658* probably null Het
Jakmip2 A T 18: 43,549,686 F691Y probably benign Het
Klhl28 A G 12: 64,957,559 F60S probably damaging Het
Loxhd1 C T 18: 77,382,023 S992L possibly damaging Het
Lrp1b A T 2: 40,922,428 probably null Het
Macf1 A T 4: 123,471,194 I3258N possibly damaging Het
Myo1b A T 1: 51,773,261 V739E probably damaging Het
Naa35 C T 13: 59,607,295 T185I probably damaging Het
Olfr1229 A G 2: 89,283,097 F33S possibly damaging Het
Olfr1418 T C 19: 11,855,587 D122G probably damaging Het
Reg4 A T 3: 98,224,766 probably benign Het
Rnaseh2b A C 14: 62,360,457 probably benign Het
Rnf123 G A 9: 108,069,103 probably benign Het
Scn8a A T 15: 101,035,498 M1528L probably benign Het
Sdr16c5 T A 4: 4,006,609 T228S probably damaging Het
Sgo2a T C 1: 58,013,646 C202R probably damaging Het
Slc25a46 A G 18: 31,583,672 L259P probably damaging Het
Slc4a4 A G 5: 89,197,766 probably benign Het
Sox14 G T 9: 99,875,583 H34Q probably damaging Het
Syna T A 5: 134,558,311 K595* probably null Het
Taf4 A G 2: 179,932,014 V687A probably benign Het
Tmbim7 C T 5: 3,661,916 H54Y probably benign Het
Vmn1r212 T C 13: 22,883,897 M89V probably benign Het
Vmn1r86 T C 7: 13,102,166 Y261C probably benign Het
Xkr4 A G 1: 3,216,191 I592T probably damaging Het
Ywhah A G 5: 33,027,005 Y184C probably damaging Het
Zkscan16 C T 4: 58,946,125 probably benign Het
Other mutations in Map4k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Map4k2 APN 19 6345593 unclassified probably null
IGL02041:Map4k2 APN 19 6351318 missense probably benign 0.45
IGL03372:Map4k2 APN 19 6342249 unclassified probably benign
IGL03380:Map4k2 APN 19 6344590 missense possibly damaging 0.83
R0968:Map4k2 UTSW 19 6345457 missense probably damaging 0.98
R1466:Map4k2 UTSW 19 6341917 missense probably damaging 1.00
R1466:Map4k2 UTSW 19 6341917 missense probably damaging 1.00
R1612:Map4k2 UTSW 19 6343341 missense probably damaging 1.00
R2069:Map4k2 UTSW 19 6342738 unclassified probably benign
R2370:Map4k2 UTSW 19 6341928 nonsense probably null
R3080:Map4k2 UTSW 19 6353188 missense probably damaging 0.99
R3825:Map4k2 UTSW 19 6344051 missense probably benign 0.29
R4088:Map4k2 UTSW 19 6353156 missense probably damaging 0.99
R4817:Map4k2 UTSW 19 6344429 missense probably damaging 0.97
R4888:Map4k2 UTSW 19 6344003 missense probably benign 0.07
R5226:Map4k2 UTSW 19 6346504 unclassified probably benign
R5544:Map4k2 UTSW 19 6345914 critical splice acceptor site probably null
R5687:Map4k2 UTSW 19 6345642 unclassified probably benign
R5688:Map4k2 UTSW 19 6346806 missense probably damaging 1.00
R5726:Map4k2 UTSW 19 6351332 missense probably damaging 0.99
R5750:Map4k2 UTSW 19 6351337 missense probably benign 0.15
R5908:Map4k2 UTSW 19 6351316 splice site probably benign
R6402:Map4k2 UTSW 19 6344081 critical splice donor site probably null
R6843:Map4k2 UTSW 19 6353447 missense probably damaging 0.98
R6942:Map4k2 UTSW 19 6346709 missense possibly damaging 0.95
R7227:Map4k2 UTSW 19 6346594 missense probably damaging 1.00
R7573:Map4k2 UTSW 19 6344064 missense probably benign
R7632:Map4k2 UTSW 19 6344054 missense probably benign
X0010:Map4k2 UTSW 19 6353318 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTCTCTTCAGCAGGAAATC -3'
(R):5'- ACTACAGCAAAGTGATGTTAGCC -3'

Sequencing Primer
(F):5'- GGAAATCACCATCCTTCGTGAATG -3'
(R):5'- AAATTTCTTCCAGACTCAGGCTGG -3'
Posted On2015-04-17