Incidental Mutation 'R6843:Map4k2'
ID534648
Institutional Source Beutler Lab
Gene Symbol Map4k2
Ensembl Gene ENSMUSG00000024948
Gene Namemitogen-activated protein kinase kinase kinase kinase 2
SynonymsRab8ip, BL44
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6341135-6355615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6353447 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 796 (I796F)
Ref Sequence ENSEMBL: ENSMUSP00000025897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000124556] [ENSMUST00000142496]
Predicted Effect probably damaging
Transcript: ENSMUST00000025897
AA Change: I796F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948
AA Change: I796F

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128170
SMART Domains Protein: ENSMUSP00000121856
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:CNH 2 142 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Map4k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Map4k2 APN 19 6345593 unclassified probably null
IGL02041:Map4k2 APN 19 6351318 missense probably benign 0.45
IGL03372:Map4k2 APN 19 6342249 unclassified probably benign
IGL03380:Map4k2 APN 19 6344590 missense possibly damaging 0.83
R0968:Map4k2 UTSW 19 6345457 missense probably damaging 0.98
R1466:Map4k2 UTSW 19 6341917 missense probably damaging 1.00
R1466:Map4k2 UTSW 19 6341917 missense probably damaging 1.00
R1612:Map4k2 UTSW 19 6343341 missense probably damaging 1.00
R2069:Map4k2 UTSW 19 6342738 unclassified probably benign
R2370:Map4k2 UTSW 19 6341928 nonsense probably null
R3080:Map4k2 UTSW 19 6353188 missense probably damaging 0.99
R3825:Map4k2 UTSW 19 6344051 missense probably benign 0.29
R3896:Map4k2 UTSW 19 6341928 nonsense probably null
R4088:Map4k2 UTSW 19 6353156 missense probably damaging 0.99
R4817:Map4k2 UTSW 19 6344429 missense probably damaging 0.97
R4888:Map4k2 UTSW 19 6344003 missense probably benign 0.07
R5226:Map4k2 UTSW 19 6346504 unclassified probably benign
R5544:Map4k2 UTSW 19 6345914 critical splice acceptor site probably null
R5687:Map4k2 UTSW 19 6345642 unclassified probably benign
R5688:Map4k2 UTSW 19 6346806 missense probably damaging 1.00
R5726:Map4k2 UTSW 19 6351332 missense probably damaging 0.99
R5750:Map4k2 UTSW 19 6351337 missense probably benign 0.15
R5908:Map4k2 UTSW 19 6351316 splice site probably benign
R6402:Map4k2 UTSW 19 6344081 critical splice donor site probably null
R6942:Map4k2 UTSW 19 6346709 missense possibly damaging 0.95
R7227:Map4k2 UTSW 19 6346594 missense probably damaging 1.00
R7573:Map4k2 UTSW 19 6344064 missense probably benign
R7632:Map4k2 UTSW 19 6344054 missense probably benign
X0010:Map4k2 UTSW 19 6353318 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTCTTCCAGGTGACGCAG -3'
(R):5'- CCTCTGGTCCAGTTATTGCTGAG -3'

Sequencing Primer
(F):5'- CTTCCAGGTGACGCAGGAGATAAC -3'
(R):5'- CCAGTTATTGCTGAGGTGGG -3'
Posted On2018-09-12