Mutagenetix > Incidental Mutations

Incidental Mutation 'R6843:Map4k2'

534648

Institutional Source

Beutler Lab

Gene Symbol

Map4k2

Ensembl Gene

ENSMUSG00000024948

Gene Name

mitogen-activated protein kinase kinase kinase kinase 2

Synonyms

Rab8ip, BL44

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.446) question?

Stock #

R6843 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

6341135-6355615 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 6353447 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 796 (I796F)

Ref Sequence

ENSEMBL: ENSMUSP00000025897 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000124556] [ENSMUST00000142496]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025897
AA Change: I796F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948
AA Change: I796F

Domain	Start	End	E-Value	Type
S_TKc	16	273	2.41e-90	SMART
low complexity region	358	369	N/A	INTRINSIC
low complexity region	425	444	N/A	INTRINSIC
CNH	488	801	1.31e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124556

SMART Domains

Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

Domain	Start	End	E-Value	Type
Pfam:Pkinase	16	56	4e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128170

SMART Domains

Protein: ENSMUSP00000121856
Gene: ENSMUSG00000024948

Domain	Start	End	E-Value	Type
Pfam:CNH	2	142	3.4e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142496

SMART Domains

Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

Domain	Start	End	E-Value	Type
Pfam:Pkinase	16	56	4e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,638,401	Q78L	probably benign	Het
Akr1c21	A	G	13: 4,575,214	H48R	probably damaging	Het
Anks1b	T	A	10: 90,948,598	S1143T	probably damaging	Het
Apip	T	G	2: 103,092,489	F217L	probably benign	Het
Ash1l	T	A	3: 88,985,388	Y1525N	probably damaging	Het
Bcl2l13	G	A	6: 120,848,617		probably null	Het
Cep85	C	G	4: 134,155,856	A241P	probably benign	Het
Clk4	T	G	11: 51,276,249		probably null	Het
Cnr2	C	T	4: 135,917,589	P326L	probably benign	Het
Cryaa	A	G	17: 31,678,173	D58G	possibly damaging	Het
Crybg3	G	A	16: 59,559,796	T365M	probably benign	Het
Csmd2	A	G	4: 128,463,794	N1683D	probably benign	Het
Dbx2	T	G	15: 95,654,459	I102L	possibly damaging	Het
Dll4	A	T	2: 119,325,994		probably benign	Het
Epb42	T	A	2: 121,027,685	Y264F	possibly damaging	Het
Exoc3l	T	A	8: 105,290,097	H695L	probably benign	Het
Fam160a1	G	A	3: 85,673,045	P618S	probably damaging	Het
Ghsr	A	C	3: 27,372,527	D244A	probably benign	Het
Gm9195	A	G	14: 72,441,211	Y2268H	possibly damaging	Het
Hdac1	A	G	4: 129,542,590	Y14H	probably damaging	Het
Hdac3	A	T	18: 37,941,954	Y282N	probably benign	Het
Heg1	T	A	16: 33,719,526	N285K	probably benign	Het
Igkv4-90	A	G	6: 68,807,686	F8S	possibly damaging	Het
Map2k1	A	T	9: 64,187,691	D336E	probably damaging	Het
Mapk13	T	A	17: 28,775,453		probably null	Het
Mprip	A	G	11: 59,759,728	I1419M	possibly damaging	Het
Nrap	T	C	19: 56,380,219	E255G	probably damaging	Het
Olfr1306	T	C	2: 111,912,915	N5S	probably damaging	Het
Olfr1357	T	C	10: 78,612,057	N195D	probably damaging	Het
Olfr1451	G	T	19: 12,998,998	C4F	probably benign	Het
Olfr549	A	G	7: 102,554,721	I146V	probably benign	Het
Olfr799	A	G	10: 129,647,179	D17G	possibly damaging	Het
Oprl1	A	G	2: 181,715,754	E11G	probably damaging	Het
Palmd	T	A	3: 116,924,215	D211V	probably damaging	Het
Pcdhga11	A	G	18: 37,756,325	N129D	probably damaging	Het
Plekha6	T	A	1: 133,274,878	M359K	probably damaging	Het
Plekha7	G	T	7: 116,143,320	H756Q	probably benign	Het
Ppfibp2	C	T	7: 107,727,731	P441S	probably benign	Het
Ptprk	T	C	10: 28,591,982	I1373T	possibly damaging	Het
Serpinb9g	G	T	13: 33,492,917	L227F	probably damaging	Het
Snapc4	C	A	2: 26,373,599	A11S	probably benign	Het
Sqor	T	C	2: 122,784,980	V7A	probably benign	Het
Sqor	G	T	2: 122,809,295	G437V	probably damaging	Het
Srrm3	T	C	5: 135,852,281	V145A	probably benign	Het
Stx1b	G	A	7: 127,814,979	Q72*	probably null	Het
Syt7	A	G	19: 10,421,771	D77G	probably damaging	Het
Tvp23a	G	A	16: 10,447,020	A9V	probably benign	Het
Vmn1r66	T	A	7: 10,274,765	I114F	probably damaging	Het
Vmn2r80	C	A	10: 79,169,668	Q380K	probably benign	Het
Xdh	C	T	17: 73,923,130	E269K	probably damaging	Het
Zfp932	T	C	5: 110,008,715	M92T	probably benign	Het

Other mutations in Map4k2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01607:Map4k2	APN	19	6345593	splice site	probably null
IGL02041:Map4k2	APN	19	6351318	missense	probably benign	0.45
IGL03372:Map4k2	APN	19	6342249	unclassified	probably benign
IGL03380:Map4k2	APN	19	6344590	missense	possibly damaging	0.83
R0968:Map4k2	UTSW	19	6345457	missense	probably damaging	0.98
R1466:Map4k2	UTSW	19	6341917	missense	probably damaging	1.00
R1466:Map4k2	UTSW	19	6341917	missense	probably damaging	1.00
R1612:Map4k2	UTSW	19	6343341	missense	probably damaging	1.00
R2069:Map4k2	UTSW	19	6342738	unclassified	probably benign
R2370:Map4k2	UTSW	19	6341928	nonsense	probably null
R3080:Map4k2	UTSW	19	6353188	missense	probably damaging	0.99
R3825:Map4k2	UTSW	19	6344051	missense	probably benign	0.29
R3896:Map4k2	UTSW	19	6341928	nonsense	probably null
R4088:Map4k2	UTSW	19	6353156	missense	probably damaging	0.99
R4817:Map4k2	UTSW	19	6344429	missense	probably damaging	0.97
R4888:Map4k2	UTSW	19	6344003	missense	probably benign	0.07
R5226:Map4k2	UTSW	19	6346504	unclassified	probably benign
R5544:Map4k2	UTSW	19	6345914	critical splice acceptor site	probably null
R5687:Map4k2	UTSW	19	6345642	unclassified	probably benign
R5688:Map4k2	UTSW	19	6346806	missense	probably damaging	1.00
R5726:Map4k2	UTSW	19	6351332	missense	probably damaging	0.99
R5750:Map4k2	UTSW	19	6351337	missense	probably benign	0.15
R5908:Map4k2	UTSW	19	6351316	splice site	probably benign
R6402:Map4k2	UTSW	19	6344081	critical splice donor site	probably null
R6942:Map4k2	UTSW	19	6346709	missense	possibly damaging	0.95
R7227:Map4k2	UTSW	19	6346594	missense	probably damaging	1.00
R7573:Map4k2	UTSW	19	6344064	missense	probably benign
R7632:Map4k2	UTSW	19	6344054	missense	probably benign
R7893:Map4k2	UTSW	19	6353511	missense	probably damaging	0.98
R8257:Map4k2	UTSW	19	6346000	missense	probably benign	0.00
R8331:Map4k2	UTSW	19	6352823	missense	probably damaging	1.00
R8343:Map4k2	UTSW	19	6346566	missense	probably damaging	1.00
X0010:Map4k2	UTSW	19	6353318	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGTCTTCCAGGTGACGCAG -3'
(R):5'- CCTCTGGTCCAGTTATTGCTGAG -3'

Sequencing Primer
(F):5'- CTTCCAGGTGACGCAGGAGATAAC -3'
(R):5'- CCAGTTATTGCTGAGGTGGG -3'

Posted On

2018-09-12