Incidental Mutation 'R4020:Gtf2a1'
ID312751
Institutional Source Beutler Lab
Gene Symbol Gtf2a1
Ensembl Gene ENSMUSG00000020962
Gene Namegeneral transcription factor II A, 1
SynonymsTfiia1, TfIIAa/b, 19kDa, 37kDa, 6330549H03Rik
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4020 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location91555262-91590487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91572577 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 94 (S94P)
Ref Sequence ENSEMBL: ENSMUSP00000068562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021345] [ENSMUST00000063314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021345
AA Change: S133P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021345
Gene: ENSMUSG00000020962
AA Change: S133P

DomainStartEndE-ValueType
TFIIA 12 378 5.47e-146 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063314
AA Change: S94P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068562
Gene: ENSMUSG00000020962
AA Change: S94P

DomainStartEndE-ValueType
Pfam:TFIIA 1 339 9.3e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116715
Meta Mutation Damage Score 0.1413 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele where D/G cleavage residues are replaced with noncleavable A/A show neonatal lethality, feeding defects, low testis weight, and male infertility associated with azoospermia, small seminiferous tubules, lack of elongating spermatids, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Gtf2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Gtf2a1 APN 12 91567833 missense probably benign 0.00
IGL02561:Gtf2a1 APN 12 91575753 missense possibly damaging 0.93
IGL03035:Gtf2a1 APN 12 91572637 splice site probably benign
PIT4618001:Gtf2a1 UTSW 12 91567769 missense probably benign 0.09
R0436:Gtf2a1 UTSW 12 91568273 splice site probably null
R1595:Gtf2a1 UTSW 12 91589549 missense probably damaging 0.98
R2240:Gtf2a1 UTSW 12 91586739 missense possibly damaging 0.87
R4043:Gtf2a1 UTSW 12 91575667 missense probably benign 0.00
R4044:Gtf2a1 UTSW 12 91575667 missense probably benign 0.00
R4095:Gtf2a1 UTSW 12 91575637 missense possibly damaging 0.68
R4584:Gtf2a1 UTSW 12 91562926 missense possibly damaging 0.66
R4585:Gtf2a1 UTSW 12 91562926 missense possibly damaging 0.66
R4952:Gtf2a1 UTSW 12 91575749 missense possibly damaging 0.70
R5465:Gtf2a1 UTSW 12 91567791 missense possibly damaging 0.86
R5566:Gtf2a1 UTSW 12 91567594 missense possibly damaging 0.63
R7055:Gtf2a1 UTSW 12 91586749 missense possibly damaging 0.93
R7220:Gtf2a1 UTSW 12 91567724 missense probably benign 0.00
R7282:Gtf2a1 UTSW 12 91567835 missense possibly damaging 0.56
R7459:Gtf2a1 UTSW 12 91575652 missense probably benign 0.00
R7484:Gtf2a1 UTSW 12 91562973 missense probably benign 0.01
X0063:Gtf2a1 UTSW 12 91572612 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCAGTGTCAGCTATGAACTATCTTGG -3'
(R):5'- ATTCGAGCTGTTGATTTCCATAGG -3'

Sequencing Primer
(F):5'- GCTATTTGCACAAATCTTCC -3'
(R):5'- TCCTGCAGCTCTGAAGTA -3'
Posted On2015-04-30