Incidental Mutation 'R4020:Crhr2'
ID312728
Institutional Source Beutler Lab
Gene Symbol Crhr2
Ensembl Gene ENSMUSG00000003476
Gene Namecorticotropin releasing hormone receptor 2
SynonymsCRF-R2, CRH-R2, Crfr2, CRF 2 receptor, CRFR2beta, CRFR2alpha
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R4020 (G1)
Quality Score223
Status Validated
Chromosome6
Chromosomal Location55090049-55133016 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 55100780 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003568] [ENSMUST00000095898] [ENSMUST00000114374] [ENSMUST00000164012] [ENSMUST00000212633] [ENSMUST00000213026]
Predicted Effect probably benign
Transcript: ENSMUST00000003568
SMART Domains Protein: ENSMUSP00000003568
Gene: ENSMUSG00000003476

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 8.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095898
SMART Domains Protein: ENSMUSP00000093586
Gene: ENSMUSG00000003476

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 1.75e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114374
SMART Domains Protein: ENSMUSP00000110015
Gene: ENSMUSG00000003476

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 3.55e-28 SMART
Pfam:7tm_2 112 354 9.7e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164012
SMART Domains Protein: ENSMUSP00000126673
Gene: ENSMUSG00000003476

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204117
Predicted Effect probably benign
Transcript: ENSMUST00000212633
Predicted Effect probably benign
Transcript: ENSMUST00000213026
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor 2 family, and the subfamily of corticotropin releasing hormone receptor. This receptor shows high affinity for corticotropin releasing hormone (CRH), and also binds CRH-related peptides such as urocortin. CRH is synthesized in the hypothalamus, and plays an important role in coordinating the endocrine, autonomic, and behavioral responses to stress and immune challenge. Studies in mice suggest that this receptor maybe involved in mediating cardiovascular homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous inactivation of this gene may result in hypersensitivity to stress, increased anxiety-like behavior, abnormal homeostatic responses to challenges of increased dietary fat and cold, and cardiovascular abnormalities, including hypertension and decreased cardiac contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Crhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Crhr2 APN 6 55103180 missense probably damaging 1.00
R0278:Crhr2 UTSW 6 55117531 missense probably benign 0.16
R1056:Crhr2 UTSW 6 55100735 missense probably damaging 1.00
R1701:Crhr2 UTSW 6 55099270 missense probably damaging 1.00
R1702:Crhr2 UTSW 6 55092535 missense probably damaging 1.00
R2697:Crhr2 UTSW 6 55102830 missense probably damaging 1.00
R4030:Crhr2 UTSW 6 55117677 missense probably benign 0.34
R4527:Crhr2 UTSW 6 55132853 utr 5 prime probably benign
R4698:Crhr2 UTSW 6 55102867 missense possibly damaging 0.90
R4737:Crhr2 UTSW 6 55091305 missense probably damaging 1.00
R5437:Crhr2 UTSW 6 55100733 missense probably damaging 1.00
R5718:Crhr2 UTSW 6 55092100 nonsense probably null
R5719:Crhr2 UTSW 6 55103222 missense probably damaging 1.00
R5945:Crhr2 UTSW 6 55100682 missense possibly damaging 0.93
R6046:Crhr2 UTSW 6 55091292 missense probably damaging 1.00
R6358:Crhr2 UTSW 6 55093043 missense probably benign 0.20
R6826:Crhr2 UTSW 6 55117740 intron probably benign
R7011:Crhr2 UTSW 6 55099210 critical splice donor site probably null
R7131:Crhr2 UTSW 6 55092127 missense
R7820:Crhr2 UTSW 6 55102779 missense probably damaging 0.97
Z1088:Crhr2 UTSW 6 55103216 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGGCCTCAAGATGAAGTGGG -3'
(R):5'- AGGGACATTGAAAACAGTGCTC -3'

Sequencing Primer
(F):5'- GAGCATGGATTTTATCAACAGTGCCC -3'
(R):5'- AGTTCTGAGCAAACCTGTGC -3'
Posted On2015-04-30