Incidental Mutation 'R4032:Pde1b'
ID313557
Institutional Source Beutler Lab
Gene Symbol Pde1b
Ensembl Gene ENSMUSG00000022489
Gene Namephosphodiesterase 1B, Ca2+-calmodulin dependent
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4032 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location103503034-103530052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103521326 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 82 (D82G)
Ref Sequence ENSEMBL: ENSMUSP00000023132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023132] [ENSMUST00000226468] [ENSMUST00000226493] [ENSMUST00000227955]
Predicted Effect probably damaging
Transcript: ENSMUST00000023132
AA Change: D82G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023132
Gene: ENSMUSG00000022489
AA Change: D82G

DomainStartEndE-ValueType
coiled coil region 38 60 N/A INTRINSIC
Pfam:PDEase_I_N 76 136 1.2e-33 PFAM
HDc 219 383 8.77e-5 SMART
Blast:HDc 394 443 1e-20 BLAST
low complexity region 467 478 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226468
AA Change: D82G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000226493
AA Change: D82G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227925
Predicted Effect probably damaging
Transcript: ENSMUST00000227955
AA Change: D63G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE1 subfamily. Members of the PDE1 family are calmodulin-dependent PDEs that are stimulated by a calcium-calmodulin complex. This PDE has dual-specificity for the second messengers, cAMP and cGMP, with a preference for cGMP as a substrate. cAMP and cGMP function as key regulators of many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased exploratory behavior. Learning deficits and hyperactivity are also observed in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap17 G T 7: 123,280,066 probably benign Het
Atp13a4 T A 16: 29,418,571 M846L probably damaging Het
Capn5 G T 7: 98,129,246 Q389K probably damaging Het
Cdkl3 T A 11: 52,011,291 I109N probably damaging Het
Cry2 T C 2: 92,413,827 I334V probably benign Het
Cs T C 10: 128,361,044 L436P probably damaging Het
D17H6S53E T C 17: 35,127,379 S89P probably benign Het
Dync1h1 C T 12: 110,618,049 Q629* probably null Het
Fam122a C T 19: 24,476,742 M205I probably benign Het
Hist1h4k T C 13: 21,750,418 I30V possibly damaging Het
Itpka C T 2: 119,742,601 P75S probably benign Het
Lyst C T 13: 13,616,665 H38Y probably damaging Het
Mansc4 T C 6: 147,075,180 K313E probably benign Het
Megf6 T A 4: 154,177,093 C58* probably null Het
Mtor T C 4: 148,536,752 V1869A probably benign Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Nek10 C A 14: 14,853,877 probably null Het
Nfkb1 T C 3: 135,594,349 S657G possibly damaging Het
Olfr447 A T 6: 42,911,625 Y34F probably benign Het
Olfr564 A G 7: 102,804,189 K237R probably benign Het
Olfr722 G T 14: 49,894,976 H275Q probably benign Het
Olfr734 T A 14: 50,320,310 D175V possibly damaging Het
Olfr976 T C 9: 39,956,333 T213A probably benign Het
Pdzrn4 C T 15: 92,769,533 T522M probably damaging Het
Ptpro C A 6: 137,461,742 N373K probably damaging Het
Ptprs T C 17: 56,413,386 Y1478C probably damaging Het
Sdc2 A T 15: 33,017,177 I46F probably damaging Het
Sergef C A 7: 46,443,302 E428* probably null Het
Stk36 A G 1: 74,626,048 S651G probably benign Het
Ubr5 A G 15: 38,024,837 V559A probably benign Het
Ugt8a C A 3: 125,874,158 D345Y probably damaging Het
Usp44 A G 10: 93,847,265 probably benign Het
Vps13a A T 19: 16,616,899 L3156Q probably damaging Het
Zfp655 A G 5: 145,244,048 T239A possibly damaging Het
Zfp72 T C 13: 74,372,330 T210A possibly damaging Het
Other mutations in Pde1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pde1b APN 15 103526680 missense probably damaging 1.00
IGL01539:Pde1b APN 15 103525345 splice site probably benign
IGL01988:Pde1b APN 15 103524856 unclassified probably null
IGL02380:Pde1b APN 15 103519990 missense possibly damaging 0.80
IGL02424:Pde1b APN 15 103528219 splice site probably benign
IGL02710:Pde1b APN 15 103522057 missense probably damaging 1.00
R0111:Pde1b UTSW 15 103503513 missense probably benign
R1302:Pde1b UTSW 15 103527599 missense probably benign 0.12
R1312:Pde1b UTSW 15 103526273 missense possibly damaging 0.71
R1449:Pde1b UTSW 15 103525043 missense probably damaging 0.99
R1631:Pde1b UTSW 15 103521672 missense probably damaging 0.97
R1848:Pde1b UTSW 15 103525340 splice site probably null
R4896:Pde1b UTSW 15 103521374 missense probably damaging 1.00
R4901:Pde1b UTSW 15 103526685 missense probably null 0.92
R5052:Pde1b UTSW 15 103527648 missense possibly damaging 0.76
R5935:Pde1b UTSW 15 103521439 missense possibly damaging 0.81
R6117:Pde1b UTSW 15 103521482 missense probably damaging 0.99
R7092:Pde1b UTSW 15 103527031 missense probably benign 0.02
R7116:Pde1b UTSW 15 103528318 missense possibly damaging 0.82
R7270:Pde1b UTSW 15 103521655 missense possibly damaging 0.76
R7359:Pde1b UTSW 15 103521325 missense probably damaging 1.00
R7464:Pde1b UTSW 15 103524829 missense probably benign 0.05
R7980:Pde1b UTSW 15 103503589 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCCTTTGCTAAGTCATGTCCATAG -3'
(R):5'- GGTTGAGAATGGGCAAACCTC -3'

Sequencing Primer
(F):5'- GATCTCACGGCCTTATACAGTGTG -3'
(R):5'- TGGGCAAACCTCACCGCTC -3'
Posted On2015-04-30