Incidental Mutation 'R8772:Fasn'
ID664481
Institutional Source Beutler Lab
Gene Symbol Fasn
Ensembl Gene ENSMUSG00000025153
Gene Namefatty acid synthase
SynonymsFAS, A630082H08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8772 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120805846-120824547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120820536 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 217 (D217E)
Ref Sequence ENSEMBL: ENSMUSP00000052872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055655] [ENSMUST00000205905] [ENSMUST00000206589]
Predicted Effect probably benign
Transcript: ENSMUST00000055655
AA Change: D217E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052872
Gene: ENSMUSG00000025153
AA Change: D217E

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 1 239 6.8e-73 PFAM
Pfam:Ketoacyl-synt_C 243 360 3.7e-38 PFAM
Pfam:KAsynt_C_assoc 362 474 8.2e-46 PFAM
Pfam:Acyl_transf_1 493 810 9.5e-115 PFAM
Pfam:PS-DH 853 1169 9.9e-24 PFAM
low complexity region 1175 1204 N/A INTRINSIC
Pfam:Methyltransf_12 1238 1337 2e-9 PFAM
PKS_ER 1532 1847 1.44e-147 SMART
PKS_KR 1878 2059 2.33e-42 SMART
Pfam:PP-binding 2119 2185 1.1e-10 PFAM
Pfam:Thioesterase 2235 2494 1.6e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205905
Predicted Effect probably benign
Transcript: ENSMUST00000206589
AA Change: D217E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutation of this locus has implicated its product in embryogenesis as all homozygotes and most heterozygotes die prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,977 V574A probably benign Het
AC157566.4 T C 15: 76,534,249 Y20C probably benign Het
Acacb A T 5: 114,184,118 D231V possibly damaging Het
Acp7 C T 7: 28,616,484 V226M probably damaging Het
Actr1a A G 19: 46,382,292 probably null Het
Adamts16 T C 13: 70,836,334 Y70C probably damaging Het
Adcy5 G A 16: 35,299,588 A1156T probably damaging Het
Akap9 G A 5: 4,046,255 E2377K probably damaging Het
Asic2 A G 11: 81,967,887 S100P probably benign Het
Atp1a1 A C 3: 101,579,808 V895G probably benign Het
B3gnt7 A G 1: 86,305,572 E180G possibly damaging Het
Cacna1c A T 6: 118,602,322 F1805I Het
Cacna1g A G 11: 94,465,887 I141T probably benign Het
Ccdc162 A G 10: 41,630,037 L919P probably damaging Het
Cd47 A G 16: 49,884,212 I116V Het
Cdca2 A T 14: 67,698,080 D395E probably damaging Het
Celsr2 A T 3: 108,397,073 I2285N possibly damaging Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Ciita A T 16: 10,480,162 I7F probably damaging Het
Dok7 G T 5: 35,077,249 G215C probably damaging Het
Eif2s2 T C 2: 154,887,739 I88V probably null Het
Fgd5 T A 6: 92,050,419 I1030N probably damaging Het
Fpr-rs6 T A 17: 20,182,233 N289Y probably damaging Het
Gm10392 C T 11: 77,518,454 V49I possibly damaging Het
Gtf3c2 A T 5: 31,174,414 M20K probably benign Het
Hoga1 A G 19: 42,045,945 M10V probably benign Het
Homer1 T A 13: 93,391,731 V258E probably damaging Het
Ifitm2 A G 7: 140,955,890 L9S probably benign Het
Iqgap3 G A 3: 88,089,837 A176T probably benign Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lyst C T 13: 13,637,492 Q830* probably null Het
Macc1 T C 12: 119,447,485 W663R probably damaging Het
Mipol1 A T 12: 57,325,632 H159L probably benign Het
Mocs1 T A 17: 49,450,374 probably null Het
Ncoa1 T C 12: 4,322,940 T154A possibly damaging Het
Noxred1 A C 12: 87,227,093 L58R probably benign Het
Olfr205 A G 16: 59,328,688 S274P probably damaging Het
Olfr78 G A 7: 102,743,003 probably benign Het
Olfr895 G A 9: 38,268,935 V133I probably benign Het
Opcml T C 9: 27,791,411 V9A probably benign Het
Otog A T 7: 46,284,928 R1303S probably damaging Het
Parp11 T A 6: 127,470,763 M20K possibly damaging Het
Parp11 T A 6: 127,491,704 I322N probably damaging Het
Pglyrp4 A T 3: 90,740,400 T356S possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Plod3 T C 5: 136,988,919 V183A probably damaging Het
Plxnb2 C T 15: 89,162,746 V791M probably damaging Het
Ppp1r7 A G 1: 93,354,428 T234A probably benign Het
Pxdn C T 12: 30,015,464 T1441I probably damaging Het
Rap1gap2 T C 11: 74,405,725 K479E probably damaging Het
Rars2 A G 4: 34,623,488 D63G probably benign Het
Rptor A C 11: 119,725,032 D124A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr1 C A 7: 29,116,132 R118L probably benign Het
Sap130 G C 18: 31,680,464 D525H probably damaging Het
Slc22a26 T C 19: 7,790,112 N310D probably benign Het
Slc46a1 T G 11: 78,465,951 N58K probably benign Het
Slc4a10 T A 2: 62,303,940 I1000N probably damaging Het
Son C T 16: 91,657,938 T1191I possibly damaging Het
Sppl2a T C 2: 126,926,311 K146E probably benign Het
Srgap3 T A 6: 112,766,945 K444I probably damaging Het
Sun1 T C 5: 139,223,692 V59A probably benign Het
Sva T A 6: 42,038,509 Y37N probably benign Het
Taar8c T A 10: 24,101,807 M36L probably benign Het
Taf4b C T 18: 14,835,852 T682I probably damaging Het
Tbx5 T A 5: 119,838,725 H59Q probably benign Het
Tdrd1 A T 19: 56,855,328 Y746F probably damaging Het
Tmem132e A G 11: 82,434,311 S46G probably damaging Het
Tnfaip6 T A 2: 52,051,065 V206E possibly damaging Het
Ttn T A 2: 76,937,681 K3025* probably null Het
Tulp4 T A 17: 6,176,893 I106N probably damaging Het
Ubp1 T A 9: 113,972,829 F454Y probably benign Het
Ugt2b37 A T 5: 87,254,486 N95K probably benign Het
Vps13d T A 4: 145,075,032 R3539W Het
Vsnl1 T C 12: 11,332,179 H67R probably damaging Het
Zbbx A G 3: 75,155,385 Y22H probably benign Het
Zeb1 A G 18: 5,770,382 probably null Het
Zfp142 A T 1: 74,571,666 L990Q possibly damaging Het
Zmiz1 G A 14: 25,645,694 G265D probably damaging Het
Other mutations in Fasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fasn APN 11 120820539 missense probably damaging 1.00
IGL01014:Fasn APN 11 120817229 missense probably damaging 0.99
IGL01131:Fasn APN 11 120814619 missense probably benign 0.01
IGL01603:Fasn APN 11 120816065 missense probably damaging 0.99
IGL01606:Fasn APN 11 120809023 critical splice donor site probably null
IGL01897:Fasn APN 11 120807939 missense probably damaging 1.00
IGL01899:Fasn APN 11 120820149 splice site probably benign
IGL01987:Fasn APN 11 120818073 missense probably damaging 1.00
IGL02103:Fasn APN 11 120811936 missense probably damaging 1.00
IGL02212:Fasn APN 11 120807903 missense probably damaging 1.00
IGL02294:Fasn APN 11 120810276 missense probably damaging 0.98
IGL02336:Fasn APN 11 120813736 missense possibly damaging 0.48
IGL02417:Fasn APN 11 120820340 missense probably damaging 1.00
IGL02452:Fasn APN 11 120808180 missense probably benign 0.00
IGL02559:Fasn APN 11 120809066 missense possibly damaging 0.51
IGL02724:Fasn APN 11 120809833 missense probably benign 0.41
IGL02862:Fasn APN 11 120818979 missense possibly damaging 0.89
IGL02947:Fasn APN 11 120815676 missense probably damaging 0.99
IGL03025:Fasn APN 11 120818148 missense probably benign 0.01
IGL03131:Fasn APN 11 120810724 missense possibly damaging 0.93
IGL03157:Fasn APN 11 120807909 missense probably benign 0.12
IGL03182:Fasn APN 11 120812726 missense probably damaging 1.00
IGL03370:Fasn APN 11 120812795 missense possibly damaging 0.95
BB007:Fasn UTSW 11 120809235 missense probably benign
BB017:Fasn UTSW 11 120809235 missense probably benign
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0243:Fasn UTSW 11 120815315 missense probably benign 0.00
R0304:Fasn UTSW 11 120819936 missense possibly damaging 0.85
R0389:Fasn UTSW 11 120816182 missense probably damaging 1.00
R0449:Fasn UTSW 11 120811068 missense probably benign
R0626:Fasn UTSW 11 120811925 missense probably damaging 0.99
R1037:Fasn UTSW 11 120809451 missense probably benign
R1061:Fasn UTSW 11 120822182 splice site probably null
R1109:Fasn UTSW 11 120812324 missense possibly damaging 0.77
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1498:Fasn UTSW 11 120815419 missense probably damaging 0.98
R1552:Fasn UTSW 11 120818558 missense probably damaging 1.00
R1568:Fasn UTSW 11 120813249 missense possibly damaging 0.78
R1624:Fasn UTSW 11 120813111 missense probably damaging 1.00
R1774:Fasn UTSW 11 120817171 missense probably damaging 1.00
R1826:Fasn UTSW 11 120808499 splice site probably benign
R1846:Fasn UTSW 11 120813307 missense probably benign 0.00
R2298:Fasn UTSW 11 120813816 missense possibly damaging 0.78
R2513:Fasn UTSW 11 120814748 missense probably damaging 1.00
R3001:Fasn UTSW 11 120809845 missense probably benign
R3002:Fasn UTSW 11 120809845 missense probably benign
R3154:Fasn UTSW 11 120807939 missense probably damaging 1.00
R3434:Fasn UTSW 11 120822773 missense probably damaging 0.99
R4794:Fasn UTSW 11 120811295 missense probably benign 0.36
R4840:Fasn UTSW 11 120813059 missense possibly damaging 0.83
R4863:Fasn UTSW 11 120808828 missense probably damaging 1.00
R4876:Fasn UTSW 11 120812312 missense probably damaging 1.00
R4914:Fasn UTSW 11 120816646 missense probably benign 0.39
R4915:Fasn UTSW 11 120816646 missense probably benign 0.39
R4916:Fasn UTSW 11 120816646 missense probably benign 0.39
R4918:Fasn UTSW 11 120816646 missense probably benign 0.39
R4936:Fasn UTSW 11 120816085 missense probably damaging 1.00
R5025:Fasn UTSW 11 120811908 missense probably benign 0.00
R5092:Fasn UTSW 11 120815036 missense probably benign 0.00
R5120:Fasn UTSW 11 120811391 missense probably benign 0.22
R5175:Fasn UTSW 11 120816369 missense probably benign 0.14
R5183:Fasn UTSW 11 120808882 missense probably benign 0.44
R5506:Fasn UTSW 11 120809510 missense probably benign 0.26
R5557:Fasn UTSW 11 120812426 missense probably benign 0.10
R5614:Fasn UTSW 11 120813328 missense probably benign
R5728:Fasn UTSW 11 120813513 missense probably benign 0.06
R5838:Fasn UTSW 11 120816124 missense probably damaging 0.98
R5959:Fasn UTSW 11 120808564 missense probably damaging 0.99
R6029:Fasn UTSW 11 120820909 missense probably damaging 1.00
R6134:Fasn UTSW 11 120822186 missense probably benign 0.05
R6335:Fasn UTSW 11 120815359 missense probably damaging 0.96
R6452:Fasn UTSW 11 120815411 missense probably damaging 1.00
R6627:Fasn UTSW 11 120818927 missense probably benign 0.10
R6742:Fasn UTSW 11 120810453 missense probably damaging 0.96
R6767:Fasn UTSW 11 120817487 missense possibly damaging 0.62
R6927:Fasn UTSW 11 120808289 missense probably benign 0.03
R6976:Fasn UTSW 11 120819867 missense probably damaging 1.00
R7092:Fasn UTSW 11 120820120 missense possibly damaging 0.56
R7157:Fasn UTSW 11 120810465 nonsense probably null
R7373:Fasn UTSW 11 120813976 missense possibly damaging 0.81
R7575:Fasn UTSW 11 120812687 missense possibly damaging 0.93
R7652:Fasn UTSW 11 120816328 missense probably damaging 0.97
R7670:Fasn UTSW 11 120813419 missense probably damaging 1.00
R7806:Fasn UTSW 11 120809995 missense probably benign 0.00
R7930:Fasn UTSW 11 120809235 missense probably benign
R8007:Fasn UTSW 11 120809527 missense probably benign
R8012:Fasn UTSW 11 120811602 missense probably damaging 1.00
R8185:Fasn UTSW 11 120812143 missense probably benign 0.42
R8557:Fasn UTSW 11 120815784 missense probably benign 0.23
R8711:Fasn UTSW 11 120819118 missense possibly damaging 0.93
R8856:Fasn UTSW 11 120818153 missense possibly damaging 0.58
R8875:Fasn UTSW 11 120812398 missense possibly damaging 0.83
X0067:Fasn UTSW 11 120816303 critical splice donor site probably null
Z1177:Fasn UTSW 11 120815471 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATTCAGAATCGTGGCATAGAC -3'
(R):5'- AAGCATTGCCCTGGACACAG -3'

Sequencing Primer
(F):5'- CAATATCCACTCCCTAGGGTAGGTC -3'
(R):5'- TGGACACAGCCTGCTCCTC -3'
Posted On2021-03-08