Incidental Mutation 'R4335:Fam71d'
ID323747
Institutional Source Beutler Lab
Gene Symbol Fam71d
Ensembl Gene ENSMUSG00000056987
Gene Namefamily with sequence similarity 71, member D
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location78691535-78734516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78712232 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 109 (S109P)
Ref Sequence ENSEMBL: ENSMUSP00000077119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077968] [ENSMUST00000218697] [ENSMUST00000219551] [ENSMUST00000220101] [ENSMUST00000220396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077968
AA Change: S109P

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077119
Gene: ENSMUSG00000056987
AA Change: S109P

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
Pfam:DUF3699 111 184 1.6e-25 PFAM
low complexity region 237 250 N/A INTRINSIC
low complexity region 265 284 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218697
Predicted Effect possibly damaging
Transcript: ENSMUST00000219551
AA Change: S109P

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219572
Predicted Effect probably benign
Transcript: ENSMUST00000220101
Predicted Effect unknown
Transcript: ENSMUST00000220396
AA Change: S80P
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Fam71d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Fam71d APN 12 78734207 critical splice donor site probably null
IGL02738:Fam71d APN 12 78734215 splice site probably benign
R0760:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R1832:Fam71d UTSW 12 78715506 unclassified probably benign
R1833:Fam71d UTSW 12 78715506 unclassified probably benign
R4437:Fam71d UTSW 12 78715050 missense probably damaging 1.00
R4850:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R5234:Fam71d UTSW 12 78715271 nonsense probably null
R5445:Fam71d UTSW 12 78715116 missense probably damaging 1.00
R5587:Fam71d UTSW 12 78715075 missense probably damaging 0.99
R5965:Fam71d UTSW 12 78710306 missense unknown
R5993:Fam71d UTSW 12 78715436 missense probably damaging 0.98
R6644:Fam71d UTSW 12 78715286 missense probably damaging 1.00
R6660:Fam71d UTSW 12 78715357 missense possibly damaging 0.88
R7052:Fam71d UTSW 12 78719402 missense probably benign 0.00
R7098:Fam71d UTSW 12 78719634 critical splice donor site probably null
R7189:Fam71d UTSW 12 78712208 missense probably benign 0.22
R7305:Fam71d UTSW 12 78715035 missense possibly damaging 0.85
R7578:Fam71d UTSW 12 78715501 critical splice donor site probably null
R7604:Fam71d UTSW 12 78715014 missense probably damaging 1.00
R7720:Fam71d UTSW 12 78712133 missense probably damaging 1.00
R7786:Fam71d UTSW 12 78719629 missense probably benign 0.18
R8008:Fam71d UTSW 12 78715043 missense probably benign 0.33
U24488:Fam71d UTSW 12 78715037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATAGCAACCCCTTTCCTG -3'
(R):5'- TGCCAGATGCCATGTAACC -3'

Sequencing Primer
(F):5'- GTTCTCTACATCCAGGTCAATAGGAG -3'
(R):5'- TGCCAGATGCCATGTAACCAAAAC -3'
Posted On2015-06-24