Incidental Mutation 'R4344:Klk1b8'
ID324264
Institutional Source Beutler Lab
Gene Symbol Klk1b8
Ensembl Gene ENSMUSG00000063089
Gene Namekallikrein 1-related peptidase b8
SynonymsmGK-8, Klk8, TADG14
MMRRC Submission 041101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4344 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43950664-43954941 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 43945762 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072204]
Predicted Effect probably benign
Transcript: ENSMUST00000072204
SMART Domains Protein: ENSMUSP00000072063
Gene: ENSMUSG00000063089

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.03e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000078897
SMART Domains Protein: ENSMUSP00000077933
Gene: ENSMUSG00000060161

DomainStartEndE-ValueType
Tryp_SPc 1 92 6.87e0 SMART
low complexity region 98 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206764
Meta Mutation Damage Score 0.3623 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,826,748 R5S possibly damaging Het
Ccdc187 T A 2: 26,280,669 K599I probably damaging Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Ces2a T G 8: 104,737,134 D159E probably damaging Het
Dcc G A 18: 71,374,490 A917V probably damaging Het
Dennd6b G A 15: 89,188,663 A196V probably benign Het
Dlgap3 T C 4: 127,214,348 S475P possibly damaging Het
Doc2a C T 7: 126,851,149 P156S probably damaging Het
Elmo1 T A 13: 20,261,552 probably null Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8251 G A 1: 44,060,991 L316F possibly damaging Het
Lmcd1 T A 6: 112,288,007 probably benign Het
Lyst T A 13: 13,698,466 I2750K probably benign Het
Muc4 A G 16: 32,770,292 N2958S possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp1r16b G A 2: 158,749,186 V163I probably damaging Het
Prkdc T A 16: 15,768,022 W2475R probably damaging Het
Rad54l C T 4: 116,097,354 C684Y probably damaging Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rasef T A 4: 73,745,089 H167L probably damaging Het
Sh3bp2 T C 5: 34,555,542 F165L possibly damaging Het
Slc38a9 T C 13: 112,729,215 I482T probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttc39c T A 18: 12,728,610 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn2r22 C T 6: 123,637,797 G278D probably damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Yme1l1 G A 2: 23,173,061 A215T probably benign Het
Zmynd15 C T 11: 70,461,068 R38* probably null Het
Other mutations in Klk1b8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Klk1b8 APN 7 43954786 missense probably benign 0.40
IGL01076:Klk1b8 APN 7 43954855 missense probably damaging 1.00
IGL01685:Klk1b8 APN 7 43954870 missense possibly damaging 0.88
IGL01771:Klk1b8 APN 7 43954866 missense probably damaging 0.99
IGL02272:Klk1b8 APN 7 43952793 missense probably damaging 1.00
IGL02596:Klk1b8 APN 7 43952763 missense probably damaging 1.00
R0789:Klk1b8 UTSW 7 43945727 unclassified probably benign
R1005:Klk1b8 UTSW 7 43954334 nonsense probably null
R1628:Klk1b8 UTSW 7 43954141 splice site probably null
R1688:Klk1b8 UTSW 7 43945805 unclassified probably benign
R1954:Klk1b8 UTSW 7 43953848 splice site probably benign
R6294:Klk1b8 UTSW 7 43952772 missense probably damaging 1.00
R6941:Klk1b8 UTSW 7 43952789 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAAGAGCTGGATTCCCTCAC -3'
(R):5'- TGAGTGAACCTTGATTTGGTCC -3'

Sequencing Primer
(F):5'- TGGATTCCCTCACCCATTGAACAG -3'
(R):5'- GATTTGGTCCTGCACTTCAGAAGC -3'
Posted On2015-06-24