Incidental Mutation 'R0789:Klk1b8'
ID76393
Institutional Source Beutler Lab
Gene Symbol Klk1b8
Ensembl Gene ENSMUSG00000063089
Gene Namekallikrein 1-related peptidase b8
SynonymsmGK-8, Klk8, TADG14
MMRRC Submission 038969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0789 (G1)
Quality Score211
Status Validated
Chromosome7
Chromosomal Location43950664-43954941 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 43945727 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072204]
Predicted Effect probably benign
Transcript: ENSMUST00000072204
SMART Domains Protein: ENSMUSP00000072063
Gene: ENSMUSG00000063089

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.03e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000078897
SMART Domains Protein: ENSMUSP00000077933
Gene: ENSMUSG00000060161

DomainStartEndE-ValueType
Tryp_SPc 1 92 6.87e0 SMART
low complexity region 98 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206764
Meta Mutation Damage Score 0.9473 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 91.7%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G T 7: 140,248,220 G114W probably damaging Het
Asb10 T C 5: 24,539,864 T111A probably damaging Het
BC024139 T C 15: 76,121,083 I526M possibly damaging Het
Cacnb4 C T 2: 52,451,883 V335I probably damaging Het
Ccdc33 C T 9: 58,117,214 probably benign Het
Cfap58 T G 19: 47,955,309 I316S probably benign Het
Chpf A T 1: 75,475,763 L349Q probably damaging Het
Cntnap1 A G 11: 101,181,384 probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Dnah1 T C 14: 31,304,591 I777V probably benign Het
Dnah11 A G 12: 117,911,232 V3966A probably damaging Het
Fbxo38 G A 18: 62,515,499 S656F possibly damaging Het
Fgf10 T A 13: 118,789,205 N173K probably benign Het
Flt1 C T 5: 147,639,483 E572K probably damaging Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Glt8d2 T C 10: 82,664,685 N77S probably damaging Het
Grem1 C A 2: 113,749,711 K148N probably benign Het
Hat1 G A 2: 71,421,744 probably benign Het
Hydin A T 8: 110,566,971 I3517F possibly damaging Het
Immt A G 6: 71,861,067 K253R probably damaging Het
Krt39 T C 11: 99,521,062 Y66C probably benign Het
Mrgprb1 T C 7: 48,456,184 probably benign Het
Nrp2 A G 1: 62,745,450 M253V probably benign Het
Olfr1111 T C 2: 87,149,827 Y278C probably damaging Het
Olfr851 C A 9: 19,497,162 P138H possibly damaging Het
Omt2b G T 9: 78,328,165 probably benign Het
Pcdh20 T C 14: 88,468,790 Y358C probably damaging Het
Pik3r4 T C 9: 105,685,167 M1215T probably benign Het
Rasal2 T C 1: 157,157,321 E927G probably damaging Het
Ryr3 A G 2: 112,780,973 probably null Het
Scaf8 T C 17: 3,196,837 C812R possibly damaging Het
Smpd4 T C 16: 17,625,826 V78A probably benign Het
Sp2 A T 11: 96,961,376 S241T probably benign Het
Tsga10 A T 1: 37,801,787 I446N possibly damaging Het
Ubr4 G A 4: 139,410,271 probably null Het
Usp44 T C 10: 93,847,220 probably benign Het
Usp54 A T 14: 20,562,157 S864T probably benign Het
Vmn2r56 A G 7: 12,732,835 Y91H probably damaging Het
Vmn2r96 T C 17: 18,582,476 V216A possibly damaging Het
Wdr17 A T 8: 54,659,572 probably benign Het
Zmym6 A G 4: 127,122,822 T799A possibly damaging Het
Znrd1as T C 17: 36,964,960 Y145H probably damaging Het
Other mutations in Klk1b8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Klk1b8 APN 7 43954786 missense probably benign 0.40
IGL01076:Klk1b8 APN 7 43954855 missense probably damaging 1.00
IGL01685:Klk1b8 APN 7 43954870 missense possibly damaging 0.88
IGL01771:Klk1b8 APN 7 43954866 missense probably damaging 0.99
IGL02272:Klk1b8 APN 7 43952793 missense probably damaging 1.00
IGL02596:Klk1b8 APN 7 43952763 missense probably damaging 1.00
R1005:Klk1b8 UTSW 7 43954334 nonsense probably null
R1628:Klk1b8 UTSW 7 43954141 splice site probably null
R1688:Klk1b8 UTSW 7 43945805 unclassified probably benign
R1954:Klk1b8 UTSW 7 43953848 splice site probably benign
R4344:Klk1b8 UTSW 7 43945762 unclassified probably benign
R6294:Klk1b8 UTSW 7 43952772 missense probably damaging 1.00
R6941:Klk1b8 UTSW 7 43952789 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGAAGACTGTCCTGTGCATCCCTC -3'
(R):5'- CTTTAGCCAACCGTACACGTACTCC -3'

Sequencing Primer
(F):5'- TGTGCATCCCTCACCACAAC -3'
(R):5'- TGGTCCTGCACTTCAGAAGC -3'
Posted On2013-10-16