Incidental Mutation 'R4399:Ibsp'
ID 325629
Institutional Source Beutler Lab
Gene Symbol Ibsp
Ensembl Gene ENSMUSG00000029306
Gene Name integrin binding sialoprotein
Synonyms Bsp2, bone sialoprotein, BSP, Bsp
MMRRC Submission 041686-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R4399 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 104447153-104459338 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104457148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 86 (S86T)
Ref Sequence ENSEMBL: ENSMUSP00000031246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031246]
AlphaFold Q61711
Predicted Effect probably damaging
Transcript: ENSMUST00000031246
AA Change: S86T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031246
Gene: ENSMUSG00000029306
AA Change: S86T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:BSP_II 17 321 2.8e-127 PFAM
Meta Mutation Damage Score 0.2023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight/size, delayed long bone growth and mineralization with low bone turn over due to reduced osteoclast formation, delayed intramembranous ossification, progressive periodontal breakdown, and severe alveolar and mandibular bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,827,211 (GRCm39) T1466A possibly damaging Het
Abcc6 T C 7: 45,652,031 (GRCm39) N612S probably benign Het
Aga T C 8: 53,964,861 (GRCm39) S8P probably benign Het
Cep152 G A 2: 125,429,900 (GRCm39) A674V possibly damaging Het
Chd6 T C 2: 160,807,238 (GRCm39) H1992R probably benign Het
Cnga1 T C 5: 72,761,724 (GRCm39) K597E probably damaging Het
Col6a5 T A 9: 105,766,164 (GRCm39) M1919L possibly damaging Het
Cramp1 C T 17: 25,198,559 (GRCm39) V788I probably damaging Het
Dnah7a T C 1: 53,557,886 (GRCm39) Y2176C probably damaging Het
Foxred2 A C 15: 77,837,558 (GRCm39) V226G possibly damaging Het
Foxred2 T C 15: 77,839,880 (GRCm39) I137V probably benign Het
G6pd2 T A 5: 61,967,516 (GRCm39) N430K probably benign Het
Gtf2h3 T C 5: 124,740,126 (GRCm39) probably benign Het
Igkv6-25 T A 6: 70,192,694 (GRCm39) S34T possibly damaging Het
Mrc2 T A 11: 105,227,484 (GRCm39) Y572* probably null Het
Mup18 C T 4: 61,590,866 (GRCm39) G97D probably damaging Het
Or1j18 A T 2: 36,625,242 (GRCm39) N303I probably benign Het
Or1p1 A G 11: 74,179,682 (GRCm39) D70G probably damaging Het
Or2ag2 G T 7: 106,485,660 (GRCm39) D121E probably damaging Het
Or4k40 T G 2: 111,251,144 (GRCm39) I51L probably benign Het
Prkcz A T 4: 155,353,534 (GRCm39) I454N possibly damaging Het
Prrg3 A T X: 71,010,915 (GRCm39) S141C probably damaging Het
Ralgapa1 T A 12: 55,842,563 (GRCm39) probably null Het
Ryr3 A T 2: 112,777,189 (GRCm39) S323T probably benign Het
Sbpl A G 17: 24,173,860 (GRCm39) L8P unknown Het
Setd1b C T 5: 123,299,861 (GRCm39) probably benign Het
Sh2d3c G A 2: 32,636,172 (GRCm39) G332D probably damaging Het
Slc2a7 A G 4: 150,243,007 (GRCm39) E276G probably damaging Het
Slc35b3 A G 13: 39,121,791 (GRCm39) F73L possibly damaging Het
Sstr3 T G 15: 78,424,324 (GRCm39) D141A probably damaging Het
St8sia5 T C 18: 77,340,714 (GRCm39) C191R probably damaging Het
Sult1c2 T C 17: 54,269,538 (GRCm39) N230S probably benign Het
Thrap3 A G 4: 126,060,872 (GRCm39) probably benign Het
Tma16 C T 8: 66,936,823 (GRCm39) probably null Het
Tmem151a A G 19: 5,133,099 (GRCm39) S36P probably damaging Het
Vmn1r67 A G 7: 10,181,476 (GRCm39) T247A possibly damaging Het
Vmn2r50 A G 7: 9,781,834 (GRCm39) S304P possibly damaging Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Vmn2r72 T C 7: 85,387,708 (GRCm39) N619D probably damaging Het
Xab2 C A 8: 3,664,244 (GRCm39) probably null Het
Other mutations in Ibsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Ibsp APN 5 104,457,934 (GRCm39) missense probably benign 0.27
IGL02317:Ibsp APN 5 104,450,332 (GRCm39) missense probably damaging 1.00
IGL02539:Ibsp APN 5 104,450,149 (GRCm39) missense probably damaging 0.99
IGL03236:Ibsp APN 5 104,453,871 (GRCm39) missense probably benign 0.30
crunch UTSW 5 104,457,148 (GRCm39) missense probably damaging 1.00
I2289:Ibsp UTSW 5 104,450,353 (GRCm39) missense possibly damaging 0.64
PIT4445001:Ibsp UTSW 5 104,450,170 (GRCm39) missense possibly damaging 0.94
R0049:Ibsp UTSW 5 104,450,024 (GRCm39) missense probably damaging 1.00
R0049:Ibsp UTSW 5 104,450,024 (GRCm39) missense probably damaging 1.00
R0234:Ibsp UTSW 5 104,457,935 (GRCm39) small deletion probably benign
R0610:Ibsp UTSW 5 104,458,000 (GRCm39) missense probably benign 0.07
R0656:Ibsp UTSW 5 104,457,886 (GRCm39) critical splice acceptor site probably null
R1168:Ibsp UTSW 5 104,450,018 (GRCm39) missense probably damaging 0.99
R1440:Ibsp UTSW 5 104,458,405 (GRCm39) missense unknown
R1569:Ibsp UTSW 5 104,458,017 (GRCm39) missense probably damaging 1.00
R1921:Ibsp UTSW 5 104,458,078 (GRCm39) missense probably damaging 1.00
R2172:Ibsp UTSW 5 104,458,296 (GRCm39) missense probably damaging 1.00
R2879:Ibsp UTSW 5 104,458,260 (GRCm39) missense possibly damaging 0.88
R4517:Ibsp UTSW 5 104,453,863 (GRCm39) nonsense probably null
R5417:Ibsp UTSW 5 104,458,335 (GRCm39) missense possibly damaging 0.95
R5575:Ibsp UTSW 5 104,457,925 (GRCm39) missense possibly damaging 0.78
R6183:Ibsp UTSW 5 104,453,896 (GRCm39) missense possibly damaging 0.95
R6273:Ibsp UTSW 5 104,458,167 (GRCm39) missense probably benign 0.15
R6295:Ibsp UTSW 5 104,449,987 (GRCm39) splice site probably null
R7061:Ibsp UTSW 5 104,457,768 (GRCm39) splice site probably null
R7133:Ibsp UTSW 5 104,450,172 (GRCm39) nonsense probably null
R7202:Ibsp UTSW 5 104,450,027 (GRCm39) missense probably benign 0.02
R7205:Ibsp UTSW 5 104,458,297 (GRCm39) missense probably damaging 0.99
R7769:Ibsp UTSW 5 104,458,050 (GRCm39) missense probably damaging 0.97
R7769:Ibsp UTSW 5 104,453,871 (GRCm39) missense probably benign 0.15
R8506:Ibsp UTSW 5 104,457,947 (GRCm39) missense probably damaging 1.00
R8840:Ibsp UTSW 5 104,458,006 (GRCm39) missense probably benign 0.00
R9396:Ibsp UTSW 5 104,458,297 (GRCm39) missense probably damaging 1.00
R9431:Ibsp UTSW 5 104,457,167 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTTAGCAACGATCTACAGAAC -3'
(R):5'- CCGTGTTTGGGGCTCATTAC -3'

Sequencing Primer
(F):5'- GTTGATTTGAGGAAATGAAAACCTG -3'
(R):5'- GGCTCATTACCTTCTTGGGCAG -3'
Posted On 2015-07-06