Incidental Mutation 'R4399:Prkcz'
ID325626
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
MMRRC Submission 041686-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4399 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155269077 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 454 (I454N)
Ref Sequence ENSEMBL: ENSMUSP00000030922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030922
AA Change: I454N

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: I454N

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103178
AA Change: I271N

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053
AA Change: I271N

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140256
Meta Mutation Damage Score 0.5671 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,936,385 T1466A possibly damaging Het
Abcc6 T C 7: 46,002,607 N612S probably benign Het
Aga T C 8: 53,511,826 S8P probably benign Het
Cep152 G A 2: 125,587,980 A674V possibly damaging Het
Chd6 T C 2: 160,965,318 H1992R probably benign Het
Cnga1 T C 5: 72,604,381 K597E probably damaging Het
Col6a5 T A 9: 105,888,965 M1919L possibly damaging Het
Cramp1l C T 17: 24,979,585 V788I probably damaging Het
Dnah7a T C 1: 53,518,727 Y2176C probably damaging Het
Foxred2 A C 15: 77,953,358 V226G possibly damaging Het
Foxred2 T C 15: 77,955,680 I137V probably benign Het
G6pd2 T A 5: 61,810,173 N430K probably benign Het
Gtf2h3 T C 5: 124,602,063 probably benign Het
Ibsp T A 5: 104,309,282 S86T probably damaging Het
Igkv6-25 T A 6: 70,215,710 S34T possibly damaging Het
Mrc2 T A 11: 105,336,658 Y572* probably null Het
Mup18 C T 4: 61,672,629 G97D probably damaging Het
Olfr1286 T G 2: 111,420,799 I51L probably benign Het
Olfr347 A T 2: 36,735,230 N303I probably benign Het
Olfr59 A G 11: 74,288,856 D70G probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ralgapa1 T A 12: 55,795,778 probably null Het
Ryr3 A T 2: 112,946,844 S323T probably benign Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Setd1b C T 5: 123,161,798 probably benign Het
Sh2d3c G A 2: 32,746,160 G332D probably damaging Het
Slc2a7 A G 4: 150,158,550 E276G probably damaging Het
Slc35b3 A G 13: 38,937,815 F73L possibly damaging Het
Sstr3 T G 15: 78,540,124 D141A probably damaging Het
St8sia5 T C 18: 77,253,018 C191R probably damaging Het
Sult1c1 T C 17: 53,962,510 N230S probably benign Het
Thrap3 A G 4: 126,167,079 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem151a A G 19: 5,083,071 S36P probably damaging Het
Vmn1r67 A G 7: 10,447,549 T247A possibly damaging Het
Vmn2r50 A G 7: 10,047,907 S304P possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1686:Prkcz UTSW 4 155271256 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5160:Prkcz UTSW 4 155293232 missense probably benign 0.22
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155289634 missense probably benign 0.01
R7108:Prkcz UTSW 4 155286793 nonsense probably null
R7241:Prkcz UTSW 4 155269059 missense probably benign 0.00
R7355:Prkcz UTSW 4 155357496 missense probably damaging 1.00
R7466:Prkcz UTSW 4 155271602 missense probably damaging 1.00
R7522:Prkcz UTSW 4 155271285 missense probably damaging 1.00
R7618:Prkcz UTSW 4 155262482 missense probably damaging 1.00
R7753:Prkcz UTSW 4 155272968 missense possibly damaging 0.61
R8079:Prkcz UTSW 4 155357505 missense probably damaging 1.00
R8407:Prkcz UTSW 4 155268216 missense probably damaging 0.99
R8523:Prkcz UTSW 4 155262511 missense probably damaging 1.00
R8824:Prkcz UTSW 4 155344828 start gained probably benign
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Z1176:Prkcz UTSW 4 155354680 missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155356468 missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155301004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCTGCCAGAGGAATGGG -3'
(R):5'- CACAGCTTCTGAGGACACAGATG -3'

Sequencing Primer
(F):5'- CCAGAGGAATGGGTTCGTG -3'
(R):5'- GATGTCCAGCACAGCGACTC -3'
Posted On2015-07-06