Mutagenetix > Incidental Mutation

Incidental Mutation 'R4410:Zbtb39'

327868

Institutional Source

Beutler Lab

Gene Symbol

Zbtb39

Ensembl Gene

ENSMUSG00000044617

Gene Name

zinc finger and BTB domain containing 39

Synonyms

MMRRC Submission

041692-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.384) question?

Stock #

R4410 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127739538-127747349 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127742827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 423 (I423M)

Ref Sequence

ENSEMBL: ENSMUSP00000052717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054287] [ENSMUST00000079692]

AlphaFold

Q6PDK0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054287
AA Change: I423M

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617
AA Change: I423M

Domain	Start	End	E-Value	Type
BTB	30	126	9.15e-24	SMART
low complexity region	197	206	N/A	INTRINSIC
low complexity region	213	229	N/A	INTRINSIC
ZnF_C2H2	372	394	6.4e0	SMART
ZnF_C2H2	400	420	3.21e1	SMART
ZnF_C2H2	451	474	9.31e1	SMART
ZnF_C2H2	480	502	6.92e0	SMART
ZnF_C2H2	508	530	1.79e-2	SMART
ZnF_C2H2	538	560	1.18e-2	SMART
ZnF_C2H2	605	627	2.57e-3	SMART
ZnF_C2H2	633	655	3.78e-1	SMART
ZnF_C2H2	661	683	2.49e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000079692

SMART Domains

Protein: ENSMUSP00000100882
Gene: ENSMUSG00000058396

Domain	Start	End	E-Value	Type
Pfam:7tm_1	66	316	1.2e-40	PFAM
low complexity region	340	352	N/A	INTRINSIC

Meta Mutation Damage Score

0.1343

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

96% (46/48)

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap39	A	T	15: 76,725,512		probably benign	Het
Arrb1	G	T	7: 99,598,296		probably benign	Het
Cadps	A	G	14: 12,822,323	M139T	probably damaging	Het
Casr	A	G	16: 36,500,341	C482R	probably benign	Het
Cdca4	A	T	12: 112,821,879	H76Q	probably benign	Het
Ddias	A	G	7: 92,858,079	L876P	probably benign	Het
Dnah9	T	C	11: 66,085,477	S1249G	possibly damaging	Het
Dnttip1	A	G	2: 164,767,819		probably benign	Het
Eme2	A	G	17: 24,893,624	S160P	probably benign	Het
Fbxw24	A	T	9: 109,608,188	D210E	probably damaging	Het
Folr2	T	C	7: 101,840,674	E129G	probably damaging	Het
Gm7682	A	T	5: 94,445,861	Q15L	probably benign	Het
Herc6	T	A	6: 57,659,679	N793K	possibly damaging	Het
Iqcg	T	G	16: 33,030,816	K262Q	possibly damaging	Het
Lhfpl3	A	G	5: 22,775,692		probably benign	Het
Lmod2	A	C	6: 24,604,630	S535R	probably damaging	Het
Lrp1b	T	A	2: 40,665,082	S342C	possibly damaging	Het
Lrrn3	T	A	12: 41,452,584	Y578F	possibly damaging	Het
Map3k4	T	A	17: 12,248,998	R1050W	probably damaging	Het
Mpp6	C	T	6: 50,198,268	Q520*	probably null	Het
Muc6	T	A	7: 141,637,663	T2301S	possibly damaging	Het
Mycbp2	T	C	14: 103,135,266	E4048G	probably damaging	Het
Myh3	G	C	11: 67,085,032	E297Q	possibly damaging	Het
Nkain3	A	G	4: 20,778,284	V11A	probably benign	Het
Olfr1189	G	A	2: 88,592,421	V206I	probably benign	Het
P3h2	G	C	16: 26,105,290	R132G	possibly damaging	Het
Phgdh	A	G	3: 98,314,275	M447T	probably benign	Het
Pmfbp1	G	A	8: 109,532,063	A667T	probably benign	Het
Psmd2	T	G	16: 20,655,026	C230G	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Slc37a3	T	A	6: 39,338,813	Y443F	probably benign	Het
Sorl1	C	A	9: 42,003,992	G1314*	probably null	Het
Spag7	T	C	11: 70,664,862	D83G	probably damaging	Het
St7	C	T	6: 17,854,933	R267*	probably null	Het
Syne2	C	T	12: 76,094,393	S99L	probably damaging	Het
Tacc2	T	G	7: 130,742,211	S2533R	possibly damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Uaca	T	G	9: 60,869,891	V518G	probably damaging	Het
Usp43	T	C	11: 67,855,890	E992G	probably benign	Het
Vmn1r55	A	G	7: 5,147,076	V116A	probably benign	Het
Wdr3	G	A	3: 100,140,227	T844M	probably benign	Het
Wdr7	T	A	18: 63,778,249	M904K	probably damaging	Het
Zmym1	A	T	4: 127,048,104	C830*	probably null	Het

Other mutations in Zbtb39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01935:Zbtb39	APN	10	127742366	missense	probably benign	0.00
R0636:Zbtb39	UTSW	10	127742835	missense	probably benign	0.01
R0959:Zbtb39	UTSW	10	127742306	missense	probably benign	0.31
R0959:Zbtb39	UTSW	10	127743062	missense	probably damaging	1.00
R0962:Zbtb39	UTSW	10	127742306	missense	probably benign	0.31
R0964:Zbtb39	UTSW	10	127742306	missense	probably benign	0.31
R1188:Zbtb39	UTSW	10	127742306	missense	probably benign	0.31
R1189:Zbtb39	UTSW	10	127742306	missense	probably benign	0.31
R1239:Zbtb39	UTSW	10	127743069	missense	probably damaging	1.00
R1341:Zbtb39	UTSW	10	127743500	missense	possibly damaging	0.91
R1838:Zbtb39	UTSW	10	127742700	missense	probably damaging	1.00
R2012:Zbtb39	UTSW	10	127742834	missense	probably benign	0.43
R2167:Zbtb39	UTSW	10	127742975	missense	probably benign	0.03
R2346:Zbtb39	UTSW	10	127741581	missense	possibly damaging	0.49
R4041:Zbtb39	UTSW	10	127743554	missense	probably damaging	1.00
R4171:Zbtb39	UTSW	10	127742367	missense	possibly damaging	0.51
R4409:Zbtb39	UTSW	10	127742827	missense	possibly damaging	0.51
R4539:Zbtb39	UTSW	10	127742192	missense	possibly damaging	0.90
R5761:Zbtb39	UTSW	10	127742646	missense	probably damaging	1.00
R5766:Zbtb39	UTSW	10	127742688	missense	probably damaging	1.00
R5812:Zbtb39	UTSW	10	127741560	start codon destroyed	probably null	0.99
R6710:Zbtb39	UTSW	10	127743636	missense	probably damaging	1.00
R6919:Zbtb39	UTSW	10	127741842	missense	probably damaging	1.00
R7941:Zbtb39	UTSW	10	127743540	missense	probably damaging	1.00
R8711:Zbtb39	UTSW	10	127742946	missense	probably damaging	1.00
X0024:Zbtb39	UTSW	10	127741766	missense	probably damaging	1.00
Z1177:Zbtb39	UTSW	10	127742427	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GGTGTGCAAGAAAGTTCTAGAGCC -3'
(R):5'- TGGCCCTTCAAGTTCACGTG -3'

Sequencing Primer
(F):5'- GTTCTAGAGCCCAACATTCAGCTG -3'
(R):5'- TCAAGTTCACGTGCTCGAG -3'

Posted On

2015-07-07