Incidental Mutation 'R4455:Mllt1'
ID329169
Institutional Source Beutler Lab
Gene Symbol Mllt1
Ensembl Gene ENSMUSG00000024212
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
SynonymsLTG19, BAM11, ENL
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56892612-56935388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56919965 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 71 (Y71H)
Ref Sequence ENSEMBL: ENSMUSP00000025053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025053]
Predicted Effect probably damaging
Transcript: ENSMUST00000025053
AA Change: Y71H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025053
Gene: ENSMUSG00000024212
AA Change: Y71H

DomainStartEndE-ValueType
Pfam:YEATS 29 110 1.9e-28 PFAM
low complexity region 284 299 N/A INTRINSIC
low complexity region 357 384 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 440 464 N/A INTRINSIC
PDB:2LM0|A 465 547 3e-31 PDB
Meta Mutation Damage Score 0.9131 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Mllt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Mllt1 APN 17 56895086 missense probably damaging 1.00
IGL02554:Mllt1 APN 17 56899806 missense probably benign
IGL03064:Mllt1 APN 17 56900094 missense probably benign 0.03
Weissblut UTSW 17 56905819 missense probably damaging 0.99
R2176:Mllt1 UTSW 17 56897398 missense probably benign 0.00
R4760:Mllt1 UTSW 17 56902630 missense probably benign 0.05
R4864:Mllt1 UTSW 17 56905819 missense probably damaging 0.99
R4914:Mllt1 UTSW 17 56899813 missense probably benign
R4916:Mllt1 UTSW 17 56899813 missense probably benign
R4917:Mllt1 UTSW 17 56899813 missense probably benign
R4918:Mllt1 UTSW 17 56899813 missense probably benign
R6169:Mllt1 UTSW 17 56899822 missense probably benign
R6508:Mllt1 UTSW 17 56927054 missense probably damaging 1.00
R7216:Mllt1 UTSW 17 56927042 missense probably damaging 1.00
RF002:Mllt1 UTSW 17 56896300 missense probably benign 0.09
RF002:Mllt1 UTSW 17 56896301 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CTCTCAGCCTATGCAAACTGC -3'
(R):5'- TAGCACTTGGTCTGTGGTAGCC -3'

Sequencing Primer
(F):5'- TGCAACTGGCTCAACCTC -3'
(R):5'- TCTGTGGTAGCCTGCCC -3'
Posted On2015-07-21