Incidental Mutation 'R4440:Fpgs'
ID329701
Institutional Source Beutler Lab
Gene Symbol Fpgs
Ensembl Gene ENSMUSG00000009566
Gene Namefolylpolyglutamyl synthetase
Synonyms
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4440 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32682609-32704145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32687501 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 219 (C219Y)
Ref Sequence ENSEMBL: ENSMUSP00000028148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009705] [ENSMUST00000028148] [ENSMUST00000127812] [ENSMUST00000146498] [ENSMUST00000167841]
Predicted Effect probably benign
Transcript: ENSMUST00000009705
SMART Domains Protein: ENSMUSP00000009705
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028148
AA Change: C219Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028148
Gene: ENSMUSG00000009566
AA Change: C219Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1jbwa2 43 327 1e-59 SMART
PDB:1O5Z|A 99 389 2e-37 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123171
Predicted Effect probably damaging
Transcript: ENSMUST00000127812
AA Change: C215Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116434
Gene: ENSMUSG00000009566
AA Change: C215Y

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 243 3e-48 SMART
PDB:1O5Z|A 56 243 4e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142186
Predicted Effect unknown
Transcript: ENSMUST00000146498
AA Change: V177M
SMART Domains Protein: ENSMUSP00000141899
Gene: ENSMUSG00000009566
AA Change: V177M

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 126 2e-14 SMART
low complexity region 136 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156792
Predicted Effect probably benign
Transcript: ENSMUST00000167841
SMART Domains Protein: ENSMUSP00000130585
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185043
Meta Mutation Damage Score 0.8088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the folylpolyglutamate synthetase enzyme. This enzyme has a central role in establishing and maintaining both cytosolic and mitochondrial folylpolyglutamate concentrations and, therefore, is essential for folate homeostasis and the survival of proliferating cells. This enzyme catalyzes the ATP-dependent addition of glutamate moieties to folate and folate derivatives. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Fpgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Fpgs APN 2 32686547 unclassified probably benign
IGL00493:Fpgs APN 2 32687997 missense possibly damaging 0.49
IGL02397:Fpgs APN 2 32685789 missense probably damaging 1.00
IGL02867:Fpgs APN 2 32685879 unclassified probably benign
IGL02889:Fpgs APN 2 32685879 unclassified probably benign
IGL03082:Fpgs APN 2 32685757 nonsense probably null
IGL03126:Fpgs APN 2 32683123 missense possibly damaging 0.86
R0243:Fpgs UTSW 2 32692494 nonsense probably null
R0312:Fpgs UTSW 2 32684801 missense probably damaging 0.99
R1326:Fpgs UTSW 2 32692580 unclassified probably null
R1558:Fpgs UTSW 2 32685840 missense possibly damaging 0.77
R1624:Fpgs UTSW 2 32691188 critical splice donor site probably null
R1934:Fpgs UTSW 2 32687981 missense probably damaging 1.00
R3706:Fpgs UTSW 2 32687996 missense probably damaging 1.00
R4439:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4868:Fpgs UTSW 2 32692661 missense probably damaging 1.00
R4979:Fpgs UTSW 2 32687367 unclassified probably benign
R5279:Fpgs UTSW 2 32692767 intron probably benign
R6337:Fpgs UTSW 2 32687941 nonsense probably null
R6648:Fpgs UTSW 2 32684787 nonsense probably null
R6668:Fpgs UTSW 2 32687606 missense probably benign 0.05
R6768:Fpgs UTSW 2 32686623 missense probably benign 0.01
R7134:Fpgs UTSW 2 32686629 missense probably benign 0.25
R7360:Fpgs UTSW 2 32693993 missense possibly damaging 0.91
R7868:Fpgs UTSW 2 32683460 missense probably damaging 1.00
R7951:Fpgs UTSW 2 32683460 missense probably damaging 1.00
Z1176:Fpgs UTSW 2 32692660 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCACAGTCATTCTTCAGTAAGCG -3'
(R):5'- TTCCTAGCCCTGTGTCTGAG -3'

Sequencing Primer
(F):5'- CATTCTTCAGTAAGCGGTAAAAGGAC -3'
(R):5'- TCCTTGGGGAGCAGAGCATG -3'
Posted On2015-07-21