Incidental Mutation 'R4474:Fbp1'
ID330497
Institutional Source Beutler Lab
Gene Symbol Fbp1
Ensembl Gene ENSMUSG00000069805
Gene Namefructose bisphosphatase 1
SynonymsFbp-2, FBPase brain isoform, Fbp3, FBPase liver
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location62864753-62888282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62875261 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 74 (L74P)
Ref Sequence ENSEMBL: ENSMUSP00000090564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092888] [ENSMUST00000134814] [ENSMUST00000150013]
Predicted Effect probably damaging
Transcript: ENSMUST00000092888
AA Change: L74P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090564
Gene: ENSMUSG00000069805
AA Change: L74P

DomainStartEndE-ValueType
Pfam:FBPase 12 334 7.3e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134814
SMART Domains Protein: ENSMUSP00000115703
Gene: ENSMUSG00000069805

DomainStartEndE-ValueType
Pfam:FBPase 12 57 3.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150013
SMART Domains Protein: ENSMUSP00000117146
Gene: ENSMUSG00000069805

DomainStartEndE-ValueType
Pfam:FBPase 1 71 5.3e-35 PFAM
Pfam:FBPase 70 130 2.7e-26 PFAM
Meta Mutation Damage Score 0.9750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fructose-1,6-bisphosphatase 1, a gluconeogenesis regulatory enzyme, catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. Fructose-1,6-diphosphatase deficiency is associated with hypoglycemia and metabolic acidosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Fbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Fbp1 APN 13 62867379 missense probably damaging 0.99
IGL02224:Fbp1 APN 13 62888007 missense probably damaging 1.00
IGL02751:Fbp1 APN 13 62875143 splice site probably null
IGL02887:Fbp1 APN 13 62869080 missense probably benign
fruko UTSW 13 62875261 missense probably damaging 1.00
PIT4362001:Fbp1 UTSW 13 62867380 missense probably damaging 0.99
R0400:Fbp1 UTSW 13 62865068 missense probably benign 0.04
R0656:Fbp1 UTSW 13 62871285 missense probably benign 0.23
R1672:Fbp1 UTSW 13 62867431 missense probably damaging 0.98
R2420:Fbp1 UTSW 13 62871306 missense probably benign 0.00
R2422:Fbp1 UTSW 13 62871306 missense probably benign 0.00
R3859:Fbp1 UTSW 13 62865116 missense probably damaging 1.00
R4990:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R4991:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R4992:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R5656:Fbp1 UTSW 13 62875196 missense probably damaging 0.97
R6463:Fbp1 UTSW 13 62865010 missense possibly damaging 0.52
R7381:Fbp1 UTSW 13 62865053 missense probably benign 0.01
R7448:Fbp1 UTSW 13 62872750 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCTTCCATGAAGCTGAGAAGG -3'
(R):5'- TGAGCTTTCCAAACAGTGTCTC -3'

Sequencing Primer
(F):5'- CTTCCATGAAGCTGAGAAGGAAAATG -3'
(R):5'- GCAAGTCCACCCTCCGTTG -3'
Posted On2015-07-21